Incidental Mutation 'R6987:Taf15'
ID543042
Institutional Source Beutler Lab
Gene Symbol Taf15
Ensembl Gene ENSMUSG00000020680
Gene NameTATA-box binding protein associated factor 15
SynonymsTAFII68, 2610111C21Rik, Taf2n, 68kDa
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.905) question?
Stock #R6987 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location83473086-83506743 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 83484695 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 31 (T31K)
Ref Sequence ENSEMBL: ENSMUSP00000021018 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021018]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021018
AA Change: T31K

PolyPhen 2 Score 0.483 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000021018
Gene: ENSMUSG00000020680
AA Change: T31K

DomainStartEndE-ValueType
low complexity region 4 30 N/A INTRINSIC
low complexity region 44 70 N/A INTRINSIC
low complexity region 72 90 N/A INTRINSIC
low complexity region 103 128 N/A INTRINSIC
low complexity region 139 150 N/A INTRINSIC
low complexity region 173 194 N/A INTRINSIC
low complexity region 201 212 N/A INTRINSIC
low complexity region 223 232 N/A INTRINSIC
RRM 233 314 1.34e-15 SMART
low complexity region 324 349 N/A INTRINSIC
ZnF_RBZ 354 380 1.62e-5 SMART
low complexity region 388 540 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133170
SMART Domains Protein: ENSMUSP00000119836
Gene: ENSMUSG00000020680

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 30 39 N/A INTRINSIC
RRM 40 121 1.34e-15 SMART
low complexity region 131 156 N/A INTRINSIC
ZnF_RBZ 161 187 1.62e-5 SMART
low complexity region 195 312 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.9%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the TET family of RNA-binding proteins. The encoded protein plays a role in RNA polymerase II gene transcription as a component of a distinct subset of multi-subunit transcription initiation factor TFIID complexes. Translocations involving this gene play a role in acute leukemia and extraskeletal myxoid chondrosarcoma, and mutations in this gene may play a role in amyotrophic lateral sclerosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, May 2012]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam10 A G 9: 70,722,696 I137V probably benign Het
Agtr1b A C 3: 20,316,421 I7S probably benign Het
Akt2 G T 7: 27,633,241 V215L probably damaging Het
Ccdc148 C A 2: 58,982,914 L294F probably damaging Het
Ccdc3 T A 2: 5,138,304 V124E possibly damaging Het
Cldnd1 A G 16: 58,731,371 D121G probably benign Het
Cnr1 A G 4: 33,944,739 I376V probably benign Het
Cyp2c40 A G 19: 39,812,767 probably benign Het
Dnah8 A G 17: 30,662,091 I601V possibly damaging Het
Dnhd1 C A 7: 105,704,585 H2982N probably damaging Het
Elavl4 A T 4: 110,251,405 D55E possibly damaging Het
Enc1 T C 13: 97,245,636 I218T probably benign Het
Fbln2 T A 6: 91,234,229 V385D probably benign Het
Ffar2 A G 7: 30,819,683 V144A possibly damaging Het
Fsip2 C T 2: 82,948,286 Q159* probably null Het
Gm14548 A G 7: 3,897,661 I30T probably damaging Het
Golga4 A G 9: 118,558,532 H1574R probably benign Het
Herc2 G A 7: 56,106,453 R747H possibly damaging Het
Lama4 A G 10: 39,074,279 N985D probably benign Het
Lrp1 T C 10: 127,575,005 N1438S probably damaging Het
Masp1 C A 16: 23,513,915 V57F probably damaging Het
Mypn T C 10: 63,193,131 E51G probably benign Het
Nos1 C T 5: 117,895,785 T324M probably benign Het
Npas3 A G 12: 54,068,253 K635E possibly damaging Het
Olfr481 C A 7: 108,081,131 C112* probably null Het
Olfr870 A T 9: 20,170,834 S246T probably benign Het
Osbp2 T C 11: 3,717,958 E13G probably damaging Het
Pkd1l1 A G 11: 8,902,575 M636T probably benign Het
Pla2g4e C T 2: 120,186,380 A227T probably benign Het
Prex2 C A 1: 11,170,752 A1028E probably damaging Het
Prr14 A G 7: 127,473,805 D49G possibly damaging Het
Slc9a9 A G 9: 94,669,990 probably benign Het
Sptb A G 12: 76,613,247 C960R probably benign Het
Tdrd9 C A 12: 112,025,593 Q601K possibly damaging Het
Tes C A 6: 17,086,155 Q16K probably benign Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Tmem168 T A 6: 13,591,477 M63L possibly damaging Het
Trav14-1 C T 14: 53,554,459 R89* probably null Het
Trp53bp2 A T 1: 182,446,635 Y615F probably damaging Het
Ttc27 T C 17: 74,777,741 probably null Het
Usp25 T A 16: 77,077,180 V548E probably damaging Het
Vmn1r124 A T 7: 21,259,818 I267K probably benign Het
Vmn1r69 A G 7: 10,580,564 M1T probably null Het
Zfp729a T A 13: 67,619,939 K724* probably null Het
Zfp850 A T 7: 27,990,001 C261S probably damaging Het
Zfp882 T A 8: 71,914,673 V448E probably benign Het
Zzef1 A G 11: 72,855,514 M881V possibly damaging Het
Other mutations in Taf15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00791:Taf15 APN 11 83488923 critical splice acceptor site probably null
IGL01151:Taf15 APN 11 83487371 missense possibly damaging 0.93
R0942:Taf15 UTSW 11 83499106 missense probably damaging 1.00
R1530:Taf15 UTSW 11 83487296 missense possibly damaging 0.86
R2267:Taf15 UTSW 11 83497262 missense probably damaging 0.98
R2437:Taf15 UTSW 11 83504753 intron probably benign
R3123:Taf15 UTSW 11 83504328 critical splice donor site probably null
R3155:Taf15 UTSW 11 83502773 missense probably benign 0.03
R3784:Taf15 UTSW 11 83506422 missense unknown
R4491:Taf15 UTSW 11 83484694 missense probably benign 0.08
R4951:Taf15 UTSW 11 83484811 missense possibly damaging 0.64
R5104:Taf15 UTSW 11 83487396 missense probably damaging 1.00
R6814:Taf15 UTSW 11 83499089 missense probably damaging 1.00
R7328:Taf15 UTSW 11 83484832 missense possibly damaging 0.96
R7431:Taf15 UTSW 11 83504953 missense unknown
R7624:Taf15 UTSW 11 83505023 missense unknown
X0028:Taf15 UTSW 11 83487396 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTAAGAGACAGGCAGAATTGTC -3'
(R):5'- CCACCATAGTTTTGTCCATACG -3'

Sequencing Primer
(F):5'- GGCAGAATTGTCGTTTAAAAGTAAGC -3'
(R):5'- CGAAGAATCAGTCGTTTGCC -3'
Posted On2018-11-28