Mutagenetix > Incidental Mutation

Incidental Mutation 'R6987:Npas3'

543043

Institutional Source

Beutler Lab

Gene Symbol

Npas3

Ensembl Gene

ENSMUSG00000021010

Gene Name

neuronal PAS domain protein 3

Synonyms

4930423H22Rik, bHLHe12

MMRRC Submission

045094-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.932) question?

Stock #

R6987 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

53248677-54072175 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 54068253 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 635 (K635E)

Ref Sequence

ENSEMBL: ENSMUSP00000152452 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000101432] [ENSMUST00000223057] [ENSMUST00000223358]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000101432
AA Change: K653E

PolyPhen 2 Score 0.786 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000098975
Gene: ENSMUSG00000021010
AA Change: K653E

Domain	Start	End	E-Value	Type
HLH	64	119	1.34e-6	SMART
PAS	154	220	8.69e-11	SMART
low complexity region	234	256	N/A	INTRINSIC
PAS	326	392	7.4e-5	SMART
PAC	398	441	2.46e-1	SMART
low complexity region	461	477	N/A	INTRINSIC
low complexity region	524	544	N/A	INTRINSIC
low complexity region	598	627	N/A	INTRINSIC
low complexity region	696	709	N/A	INTRINSIC
low complexity region	739	754	N/A	INTRINSIC
low complexity region	759	773	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000223057
AA Change: K635E

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000223358
AA Change: K622E

PolyPhen 2 Score 0.863 (Sensitivity: 0.83; Specificity: 0.93)

Meta Mutation Damage Score

0.1208

Coding Region Coverage

1x: 100.0%
3x: 99.8%
10x: 99.0%
20x: 96.9%

Validation Efficiency

100% (47/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the basic helix-loop-helix and PAS domain-containing family of transcription factors. The encoded protein is localized to the nucleus and may regulate genes involved in neurogenesis. Chromosomal abnormalities that affect the coding potential of this gene are associated with schizophrenia and mental retardation. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for some knock-out alleles exhibit abnormal behavior and nervous system morphology. Mice homozygous for another knock-out allele exhibit defective lung branching morphogenesis and die shortly after birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam10	A	G	9: 70,722,696	I137V	probably benign	Het
Agtr1b	A	C	3: 20,316,421	I7S	probably benign	Het
Akt2	G	T	7: 27,633,241	V215L	probably damaging	Het
Ccdc148	C	A	2: 58,982,914	L294F	probably damaging	Het
Ccdc3	T	A	2: 5,138,304	V124E	possibly damaging	Het
Cldnd1	A	G	16: 58,731,371	D121G	probably benign	Het
Cnr1	A	G	4: 33,944,739	I376V	probably benign	Het
Cyp2c40	A	G	19: 39,812,767		probably benign	Het
Dnah8	A	G	17: 30,662,091	I601V	possibly damaging	Het
Dnhd1	C	A	7: 105,704,585	H2982N	probably damaging	Het
Elavl4	A	T	4: 110,251,405	D55E	possibly damaging	Het
Enc1	T	C	13: 97,245,636	I218T	probably benign	Het
Fbln2	T	A	6: 91,234,229	V385D	probably benign	Het
Ffar2	A	G	7: 30,819,683	V144A	possibly damaging	Het
Fsip2	C	T	2: 82,948,286	Q159*	probably null	Het
Gm14548	A	G	7: 3,897,661	I30T	probably damaging	Het
Golga4	A	G	9: 118,558,532	H1574R	probably benign	Het
Herc2	G	A	7: 56,106,453	R747H	possibly damaging	Het
Lama4	A	G	10: 39,074,279	N985D	probably benign	Het
Lrp1	T	C	10: 127,575,005	N1438S	probably damaging	Het
Masp1	C	A	16: 23,513,915	V57F	probably damaging	Het
Mypn	T	C	10: 63,193,131	E51G	probably benign	Het
Nos1	C	T	5: 117,895,785	T324M	probably benign	Het
Olfr481	C	A	7: 108,081,131	C112*	probably null	Het
Olfr870	A	T	9: 20,170,834	S246T	probably benign	Het
Osbp2	T	C	11: 3,717,958	E13G	probably damaging	Het
Pkd1l1	A	G	11: 8,902,575	M636T	probably benign	Het
Pla2g4e	C	T	2: 120,186,380	A227T	probably benign	Het
Prex2	C	A	1: 11,170,752	A1028E	probably damaging	Het
Prr14	A	G	7: 127,473,805	D49G	possibly damaging	Het
Slc9a9	A	G	9: 94,669,990		probably benign	Het
Sptb	A	G	12: 76,613,247	C960R	probably benign	Het
Taf15	C	A	11: 83,484,695	T31K	possibly damaging	Het
Tdrd9	C	A	12: 112,025,593	Q601K	possibly damaging	Het
Tes	C	A	6: 17,086,155	Q16K	probably benign	Het
Ticam1	C	T	17: 56,269,900	E732K	probably benign	Het
Tmem168	T	A	6: 13,591,477	M63L	possibly damaging	Het
Trav14-1	C	T	14: 53,554,459	R89*	probably null	Het
Trp53bp2	A	T	1: 182,446,635	Y615F	probably damaging	Het
Ttc27	T	C	17: 74,777,741		probably null	Het
Usp25	T	A	16: 77,077,180	V548E	probably damaging	Het
Vmn1r124	A	T	7: 21,259,818	I267K	probably benign	Het
Vmn1r69	A	G	7: 10,580,564	M1T	probably null	Het
Zfp729a	T	A	13: 67,619,939	K724*	probably null	Het
Zfp850	A	T	7: 27,990,001	C261S	probably damaging	Het
Zfp882	T	A	8: 71,914,673	V448E	probably benign	Het
Zzef1	A	G	11: 72,855,514	M881V	possibly damaging	Het

Other mutations in Npas3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01021:Npas3	APN	12	54003560	missense	probably damaging	1.00
IGL01330:Npas3	APN	12	54048819	missense	probably damaging	1.00
IGL01376:Npas3	APN	12	54044586	missense	probably benign	0.01
IGL01634:Npas3	APN	12	53947163	missense	probably damaging	1.00
IGL02456:Npas3	APN	12	54048767	missense	probably damaging	0.99
IGL02663:Npas3	APN	12	54068908	missense	probably damaging	1.00
IGL02731:Npas3	APN	12	54067795	missense	probably benign	0.01
IGL02955:Npas3	APN	12	53501265	missense	probably damaging	0.96
IGL03001:Npas3	APN	12	53501192	missense	probably damaging	1.00
IGL03047:Npas3	APN	12	53831687	splice site	probably benign
ANU05:Npas3	UTSW	12	54068074	missense	possibly damaging	0.49
IGL02837:Npas3	UTSW	12	53947197	missense	possibly damaging	0.79
R0042:Npas3	UTSW	12	54048841	missense	probably damaging	1.00
R0042:Npas3	UTSW	12	54048841	missense	probably damaging	1.00
R0396:Npas3	UTSW	12	53831745	missense	probably damaging	1.00
R1687:Npas3	UTSW	12	54048875	splice site	probably null
R1863:Npas3	UTSW	12	54068826	missense	probably damaging	1.00
R2004:Npas3	UTSW	12	54067897	missense	possibly damaging	0.63
R2047:Npas3	UTSW	12	54068829	missense	probably damaging	0.99
R2049:Npas3	UTSW	12	54062088	missense	probably damaging	1.00
R2278:Npas3	UTSW	12	53640502	missense	possibly damaging	0.92
R2323:Npas3	UTSW	12	54068346	missense	probably damaging	1.00
R2871:Npas3	UTSW	12	54068013	nonsense	probably null
R2871:Npas3	UTSW	12	54068013	nonsense	probably null
R3116:Npas3	UTSW	12	54067725	splice site	probably null
R3431:Npas3	UTSW	12	54069049	missense	probably damaging	0.99
R3731:Npas3	UTSW	12	53354392	missense	probably benign	0.11
R3767:Npas3	UTSW	12	54069074	makesense	probably null
R4332:Npas3	UTSW	12	54062069	missense	probably damaging	0.99
R4593:Npas3	UTSW	12	54068497	missense	probably benign	0.08
R4601:Npas3	UTSW	12	54044578	missense	probably damaging	0.99
R4654:Npas3	UTSW	12	54062132	critical splice donor site	probably null
R4946:Npas3	UTSW	12	54065835	missense	probably damaging	1.00
R5140:Npas3	UTSW	12	53501114	nonsense	probably null
R5302:Npas3	UTSW	12	54068836	missense	probably damaging	1.00
R5524:Npas3	UTSW	12	54068938	missense	possibly damaging	0.64
R5735:Npas3	UTSW	12	54003479	missense	probably benign	0.00
R6252:Npas3	UTSW	12	54068890	missense	probably damaging	1.00
R6438:Npas3	UTSW	12	54068698	missense	probably damaging	0.99
R6994:Npas3	UTSW	12	54068793	missense	probably damaging	0.96
R7304:Npas3	UTSW	12	54069041	missense	probably damaging	1.00
R7684:Npas3	UTSW	12	54068826	missense	probably damaging	1.00
R7724:Npas3	UTSW	12	54068341	missense	possibly damaging	0.90
R7739:Npas3	UTSW	12	54068718	missense	probably damaging	1.00
R7826:Npas3	UTSW	12	53831756	missense	possibly damaging	0.92
R8017:Npas3	UTSW	12	54044679	missense	probably damaging	1.00
R8019:Npas3	UTSW	12	54044679	missense	probably damaging	1.00
R8034:Npas3	UTSW	12	53640529	missense	probably damaging	1.00
R8422:Npas3	UTSW	12	54068509	missense	probably benign
R9172:Npas3	UTSW	12	54065870	missense	probably benign	0.08
R9207:Npas3	UTSW	12	54068035	missense	possibly damaging	0.87
R9774:Npas3	UTSW	12	53947325	missense	probably damaging	1.00
X0003:Npas3	UTSW	12	54044728	splice site	probably null
X0064:Npas3	UTSW	12	53354384	missense	probably damaging	0.96
Z1176:Npas3	UTSW	12	53501180	missense	probably damaging	0.99
Z1177:Npas3	UTSW	12	53947206	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGATCAAAGTGGAGCGCTACG -3'
(R):5'- TGCCGCTGAACTGAGTCTTG -3'

Sequencing Primer
(F):5'- GCCAAGGACTCAGACAGCG -3'
(R):5'- TGAACTGAGTCTTGCGGCCAG -3'

Posted On

2018-11-28