Mutagenetix > Incidental Mutation

Incidental Mutation 'R6987:Tdrd9'

543045

Institutional Source

Beutler Lab

Gene Symbol

Tdrd9

Ensembl Gene

ENSMUSG00000054003

Gene Name

tudor domain containing 9

Synonyms

MMRRC Submission

045094-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.163) question?

Stock #

R6987 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

111971559-112068854 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 112025593 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Lysine at position 601 (Q601K)

Ref Sequence

ENSEMBL: ENSMUSP00000078022 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079009]

AlphaFold

Q14BI7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000079009
AA Change: Q601K

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000078022
Gene: ENSMUSG00000054003
AA Change: Q601K

Domain	Start	End	E-Value	Type
low complexity region	29	40	N/A	INTRINSIC
low complexity region	70	81	N/A	INTRINSIC
DEXDc	132	327	5.64e-21	SMART
HELICc	404	502	3.22e-16	SMART
low complexity region	547	561	N/A	INTRINSIC
HA2	565	666	1.9e-20	SMART
TUDOR	944	1003	1.52e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000192125

Coding Region Coverage

1x: 100.0%
3x: 99.8%
10x: 99.0%
20x: 96.9%

Validation Efficiency

100% (47/47)

MGI Phenotype

PHENOTYPE: Male homozygous mice are sterile, displaying small testis, arrest of male meiosis and abnormal spermatocyte morphology. Females are fertile. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam10	A	G	9: 70,722,696	I137V	probably benign	Het
Agtr1b	A	C	3: 20,316,421	I7S	probably benign	Het
Akt2	G	T	7: 27,633,241	V215L	probably damaging	Het
Ccdc148	C	A	2: 58,982,914	L294F	probably damaging	Het
Ccdc3	T	A	2: 5,138,304	V124E	possibly damaging	Het
Cldnd1	A	G	16: 58,731,371	D121G	probably benign	Het
Cnr1	A	G	4: 33,944,739	I376V	probably benign	Het
Cyp2c40	A	G	19: 39,812,767		probably benign	Het
Dnah8	A	G	17: 30,662,091	I601V	possibly damaging	Het
Dnhd1	C	A	7: 105,704,585	H2982N	probably damaging	Het
Elavl4	A	T	4: 110,251,405	D55E	possibly damaging	Het
Enc1	T	C	13: 97,245,636	I218T	probably benign	Het
Fbln2	T	A	6: 91,234,229	V385D	probably benign	Het
Ffar2	A	G	7: 30,819,683	V144A	possibly damaging	Het
Fsip2	C	T	2: 82,948,286	Q159*	probably null	Het
Gm14548	A	G	7: 3,897,661	I30T	probably damaging	Het
Golga4	A	G	9: 118,558,532	H1574R	probably benign	Het
Herc2	G	A	7: 56,106,453	R747H	possibly damaging	Het
Lama4	A	G	10: 39,074,279	N985D	probably benign	Het
Lrp1	T	C	10: 127,575,005	N1438S	probably damaging	Het
Masp1	C	A	16: 23,513,915	V57F	probably damaging	Het
Mypn	T	C	10: 63,193,131	E51G	probably benign	Het
Nos1	C	T	5: 117,895,785	T324M	probably benign	Het
Npas3	A	G	12: 54,068,253	K635E	possibly damaging	Het
Olfr481	C	A	7: 108,081,131	C112*	probably null	Het
Olfr870	A	T	9: 20,170,834	S246T	probably benign	Het
Osbp2	T	C	11: 3,717,958	E13G	probably damaging	Het
Pkd1l1	A	G	11: 8,902,575	M636T	probably benign	Het
Pla2g4e	C	T	2: 120,186,380	A227T	probably benign	Het
Prex2	C	A	1: 11,170,752	A1028E	probably damaging	Het
Prr14	A	G	7: 127,473,805	D49G	possibly damaging	Het
Slc9a9	A	G	9: 94,669,990		probably benign	Het
Sptb	A	G	12: 76,613,247	C960R	probably benign	Het
Taf15	C	A	11: 83,484,695	T31K	possibly damaging	Het
Tes	C	A	6: 17,086,155	Q16K	probably benign	Het
Ticam1	C	T	17: 56,269,900	E732K	probably benign	Het
Tmem168	T	A	6: 13,591,477	M63L	possibly damaging	Het
Trav14-1	C	T	14: 53,554,459	R89*	probably null	Het
Trp53bp2	A	T	1: 182,446,635	Y615F	probably damaging	Het
Ttc27	T	C	17: 74,777,741		probably null	Het
Usp25	T	A	16: 77,077,180	V548E	probably damaging	Het
Vmn1r124	A	T	7: 21,259,818	I267K	probably benign	Het
Vmn1r69	A	G	7: 10,580,564	M1T	probably null	Het
Zfp729a	T	A	13: 67,619,939	K724*	probably null	Het
Zfp850	A	T	7: 27,990,001	C261S	probably damaging	Het
Zfp882	T	A	8: 71,914,673	V448E	probably benign	Het
Zzef1	A	G	11: 72,855,514	M881V	possibly damaging	Het

Other mutations in Tdrd9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01339:Tdrd9	APN	12	112040434	missense	probably damaging	1.00
IGL01373:Tdrd9	APN	12	112040434	missense	probably damaging	1.00
IGL01542:Tdrd9	APN	12	112046989	missense	possibly damaging	0.94
IGL02967:Tdrd9	APN	12	111992488	missense	possibly damaging	0.50
IGL03063:Tdrd9	APN	12	112044299	missense	probably benign	0.00
IGL03107:Tdrd9	APN	12	112042840	missense	probably damaging	0.98
R0433:Tdrd9	UTSW	12	112025581	nonsense	probably null
R0453:Tdrd9	UTSW	12	112068239	missense	probably benign
R0655:Tdrd9	UTSW	12	112040465	missense	probably damaging	1.00
R0666:Tdrd9	UTSW	12	112007580	intron	probably benign
R1073:Tdrd9	UTSW	12	112023259	missense	probably damaging	1.00
R1280:Tdrd9	UTSW	12	112039408	missense	probably damaging	1.00
R1386:Tdrd9	UTSW	12	112044804	missense	probably benign	0.21
R1521:Tdrd9	UTSW	12	112036410	missense	probably damaging	1.00
R1601:Tdrd9	UTSW	12	112023253	nonsense	probably null
R1651:Tdrd9	UTSW	12	112024706	missense	probably damaging	0.97
R1715:Tdrd9	UTSW	12	112036439	missense	possibly damaging	0.62
R1854:Tdrd9	UTSW	12	112044812	missense	probably damaging	1.00
R1905:Tdrd9	UTSW	12	112063627	splice site	probably benign
R2386:Tdrd9	UTSW	12	112015900	missense	probably damaging	1.00
R2863:Tdrd9	UTSW	12	112031261	missense	probably benign
R2915:Tdrd9	UTSW	12	112040461	missense	probably damaging	1.00
R2958:Tdrd9	UTSW	12	112041672	missense	probably damaging	0.97
R4033:Tdrd9	UTSW	12	111992539	missense	possibly damaging	0.58
R4087:Tdrd9	UTSW	12	112013486	nonsense	probably null
R4237:Tdrd9	UTSW	12	112067625	nonsense	probably null
R4482:Tdrd9	UTSW	12	112014501	critical splice donor site	probably null
R4501:Tdrd9	UTSW	12	112042809	missense	probably benign	0.00
R4502:Tdrd9	UTSW	12	111993825	missense	probably damaging	1.00
R4715:Tdrd9	UTSW	12	112041689	missense	probably benign	0.00
R4803:Tdrd9	UTSW	12	111996835	nonsense	probably null
R5218:Tdrd9	UTSW	12	112063475	intron	probably benign
R5275:Tdrd9	UTSW	12	112051912	nonsense	probably null
R5295:Tdrd9	UTSW	12	112051912	nonsense	probably null
R5301:Tdrd9	UTSW	12	112036529	critical splice donor site	probably null
R5339:Tdrd9	UTSW	12	112027122	missense	probably damaging	1.00
R5500:Tdrd9	UTSW	12	112023268	missense	probably benign	0.02
R5573:Tdrd9	UTSW	12	111997902	splice site	probably null
R5590:Tdrd9	UTSW	12	112051980	missense	probably benign	0.01
R5891:Tdrd9	UTSW	12	112042719	missense	probably damaging	1.00
R6056:Tdrd9	UTSW	12	111985041	missense	probably damaging	1.00
R6057:Tdrd9	UTSW	12	112013286	missense	possibly damaging	0.85
R6125:Tdrd9	UTSW	12	112068198	missense	possibly damaging	0.89
R6254:Tdrd9	UTSW	12	112025900	splice site	probably null
R6335:Tdrd9	UTSW	12	112041752	critical splice donor site	probably null
R6345:Tdrd9	UTSW	12	112034608	missense	probably damaging	0.99
R6792:Tdrd9	UTSW	12	112027113	missense	probably benign	0.01
R6956:Tdrd9	UTSW	12	112036354	splice site	probably benign
R7090:Tdrd9	UTSW	12	111992470	missense	probably benign
R7158:Tdrd9	UTSW	12	112036366	missense	probably benign	0.08
R7220:Tdrd9	UTSW	12	112014454	missense	probably damaging	1.00
R7478:Tdrd9	UTSW	12	111985042	missense	probably damaging	1.00
R7489:Tdrd9	UTSW	12	112067637	missense	probably benign	0.00
R7751:Tdrd9	UTSW	12	111992548	missense	probably benign	0.09
R7809:Tdrd9	UTSW	12	112032721	missense	probably damaging	0.99
R7844:Tdrd9	UTSW	12	111997952	missense	possibly damaging	0.63
R7854:Tdrd9	UTSW	12	112046961	missense	probably benign	0.00
R7903:Tdrd9	UTSW	12	112051976	missense	possibly damaging	0.95
R7938:Tdrd9	UTSW	12	112031215	missense	possibly damaging	0.86
R8018:Tdrd9	UTSW	12	112032746	missense	probably benign	0.12
R8018:Tdrd9	UTSW	12	112044388	missense	probably damaging	0.99
R8090:Tdrd9	UTSW	12	112015935	missense	probably damaging	1.00
R8157:Tdrd9	UTSW	12	111985066	missense	probably benign	0.44
R8198:Tdrd9	UTSW	12	112040429	missense	probably damaging	1.00
R8203:Tdrd9	UTSW	12	112025630	missense	probably damaging	1.00
R8512:Tdrd9	UTSW	12	112046193	missense	probably benign
R8721:Tdrd9	UTSW	12	112036455	missense	probably damaging	1.00
R8889:Tdrd9	UTSW	12	112013284	missense	probably benign	0.07
R8892:Tdrd9	UTSW	12	112013284	missense	probably benign	0.07
R9276:Tdrd9	UTSW	12	112014501	critical splice donor site	probably null
R9459:Tdrd9	UTSW	12	112025573	missense	probably damaging	1.00
R9484:Tdrd9	UTSW	12	112046250	missense	probably damaging	0.97
R9657:Tdrd9	UTSW	12	112036390	missense	possibly damaging	0.50
R9745:Tdrd9	UTSW	12	112042696	missense	probably damaging	0.99
X0018:Tdrd9	UTSW	12	112039329	missense	probably benign	0.24
Z1177:Tdrd9	UTSW	12	111971654	missense	probably benign	0.08
Z1177:Tdrd9	UTSW	12	111993891	missense	probably damaging	0.96
Z1177:Tdrd9	UTSW	12	112015921	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTCTCAGAACCTTACTCACCAG -3'
(R):5'- TTCAGAGAAAGAGCTGCCGC -3'

Sequencing Primer
(F):5'- AGCTGGTGTACCGCCTGTC -3'
(R):5'- AACAGAGTATGAAGCCCG -3'

Posted On

2018-11-28