Incidental Mutation 'R6987:Zfp729a'
ID543046
Institutional Source Beutler Lab
Gene Symbol Zfp729a
Ensembl Gene ENSMUSG00000021510
Gene Namezinc finger protein 729a
SynonymsA530054K11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R6987 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location67612763-67637791 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 67619939 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 724 (K724*)
Ref Sequence ENSEMBL: ENSMUSP00000012314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012314] [ENSMUST00000224814] [ENSMUST00000225627]
Predicted Effect probably null
Transcript: ENSMUST00000012314
AA Change: K724*
SMART Domains Protein: ENSMUSP00000012314
Gene: ENSMUSG00000021510
AA Change: K724*

DomainStartEndE-ValueType
KRAB 15 75 6.23e-34 SMART
ZnF_C2H2 91 111 1.91e1 SMART
ZnF_C2H2 147 169 8.34e-3 SMART
PHD 148 209 9.1e0 SMART
ZnF_C2H2 175 197 3.21e-4 SMART
ZnF_C2H2 203 225 6.78e-3 SMART
ZnF_C2H2 231 253 4.47e-3 SMART
PHD 232 293 1.11e1 SMART
RING 233 292 9.27e0 SMART
ZnF_C2H2 259 281 6.67e-2 SMART
ZnF_C2H2 287 309 1.12e-3 SMART
ZnF_C2H2 315 337 3.83e-2 SMART
PHD 316 377 1.35e1 SMART
ZnF_C2H2 343 365 2.57e-3 SMART
ZnF_C2H2 371 393 1.98e-4 SMART
Pfam:zf-C2HC_2 402 422 7.7e-4 PFAM
ZnF_C2H2 427 449 1.67e-2 SMART
ZnF_C2H2 455 477 1.38e-3 SMART
PHD 456 517 5.33e0 SMART
RING 457 516 9.02e0 SMART
ZnF_C2H2 483 505 3.89e-3 SMART
ZnF_C2H2 511 533 7.49e-5 SMART
ZnF_C2H2 539 561 5.5e-3 SMART
PHD 540 601 1.46e1 SMART
ZnF_C2H2 567 589 3.58e-2 SMART
ZnF_C2H2 595 617 8.34e-3 SMART
ZnF_C2H2 651 673 4.11e-2 SMART
PHD 652 713 4.64e0 SMART
RING 653 712 6.37e0 SMART
ZnF_C2H2 679 701 2.4e-3 SMART
ZnF_C2H2 707 729 1.03e-2 SMART
ZnF_C2H2 735 757 1.47e-3 SMART
PHD 736 797 5.44e0 SMART
RING 737 796 5.88e0 SMART
ZnF_C2H2 763 785 6.67e-2 SMART
ZnF_C2H2 791 813 2.36e-2 SMART
ZnF_C2H2 819 841 6.32e-3 SMART
ZnF_C2H2 847 869 1.26e-2 SMART
ZnF_C2H2 875 897 6.78e-3 SMART
PHD 876 937 4.55e0 SMART
ZnF_C2H2 903 925 9.58e-3 SMART
ZnF_C2H2 931 953 9.08e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000224814
Predicted Effect probably benign
Transcript: ENSMUST00000225627
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.9%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam10 A G 9: 70,722,696 I137V probably benign Het
Agtr1b A C 3: 20,316,421 I7S probably benign Het
Akt2 G T 7: 27,633,241 V215L probably damaging Het
Ccdc148 C A 2: 58,982,914 L294F probably damaging Het
Ccdc3 T A 2: 5,138,304 V124E possibly damaging Het
Cldnd1 A G 16: 58,731,371 D121G probably benign Het
Cnr1 A G 4: 33,944,739 I376V probably benign Het
Cyp2c40 A G 19: 39,812,767 probably benign Het
Dnah8 A G 17: 30,662,091 I601V possibly damaging Het
Dnhd1 C A 7: 105,704,585 H2982N probably damaging Het
Elavl4 A T 4: 110,251,405 D55E possibly damaging Het
Enc1 T C 13: 97,245,636 I218T probably benign Het
Fbln2 T A 6: 91,234,229 V385D probably benign Het
Ffar2 A G 7: 30,819,683 V144A possibly damaging Het
Fsip2 C T 2: 82,948,286 Q159* probably null Het
Gm14548 A G 7: 3,897,661 I30T probably damaging Het
Golga4 A G 9: 118,558,532 H1574R probably benign Het
Herc2 G A 7: 56,106,453 R747H possibly damaging Het
Lama4 A G 10: 39,074,279 N985D probably benign Het
Lrp1 T C 10: 127,575,005 N1438S probably damaging Het
Masp1 C A 16: 23,513,915 V57F probably damaging Het
Mypn T C 10: 63,193,131 E51G probably benign Het
Nos1 C T 5: 117,895,785 T324M probably benign Het
Npas3 A G 12: 54,068,253 K635E possibly damaging Het
Olfr481 C A 7: 108,081,131 C112* probably null Het
Olfr870 A T 9: 20,170,834 S246T probably benign Het
Osbp2 T C 11: 3,717,958 E13G probably damaging Het
Pkd1l1 A G 11: 8,902,575 M636T probably benign Het
Pla2g4e C T 2: 120,186,380 A227T probably benign Het
Prex2 C A 1: 11,170,752 A1028E probably damaging Het
Prr14 A G 7: 127,473,805 D49G possibly damaging Het
Slc9a9 A G 9: 94,669,990 probably benign Het
Sptb A G 12: 76,613,247 C960R probably benign Het
Taf15 C A 11: 83,484,695 T31K possibly damaging Het
Tdrd9 C A 12: 112,025,593 Q601K possibly damaging Het
Tes C A 6: 17,086,155 Q16K probably benign Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Tmem168 T A 6: 13,591,477 M63L possibly damaging Het
Trav14-1 C T 14: 53,554,459 R89* probably null Het
Trp53bp2 A T 1: 182,446,635 Y615F probably damaging Het
Ttc27 T C 17: 74,777,741 probably null Het
Usp25 T A 16: 77,077,180 V548E probably damaging Het
Vmn1r124 A T 7: 21,259,818 I267K probably benign Het
Vmn1r69 A G 7: 10,580,564 M1T probably null Het
Zfp850 A T 7: 27,990,001 C261S probably damaging Het
Zfp882 T A 8: 71,914,673 V448E probably benign Het
Zzef1 A G 11: 72,855,514 M881V possibly damaging Het
Other mutations in Zfp729a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Zfp729a APN 13 67619321 missense probably benign 0.01
IGL01956:Zfp729a APN 13 67621686 missense probably damaging 1.00
IGL02852:Zfp729a APN 13 67619951 missense possibly damaging 0.69
IGL03130:Zfp729a APN 13 67619642 intron probably null
adalet UTSW 13 67619507 missense probably benign 0.00
R0329:Zfp729a UTSW 13 67620354 missense probably damaging 1.00
R0330:Zfp729a UTSW 13 67620354 missense probably damaging 1.00
R0383:Zfp729a UTSW 13 67621673 missense possibly damaging 0.83
R0545:Zfp729a UTSW 13 67620226 missense probably benign 0.09
R1013:Zfp729a UTSW 13 67619507 missense probably benign 0.00
R1079:Zfp729a UTSW 13 67619675 missense possibly damaging 0.71
R1255:Zfp729a UTSW 13 67621846 missense probably benign 0.03
R1525:Zfp729a UTSW 13 67619321 missense probably benign 0.01
R1768:Zfp729a UTSW 13 67619251 missense probably benign 0.00
R1926:Zfp729a UTSW 13 67619557 missense probably benign 0.29
R2043:Zfp729a UTSW 13 67621172 missense probably damaging 1.00
R2118:Zfp729a UTSW 13 67621494 intron probably null
R3820:Zfp729a UTSW 13 67621319 missense probably damaging 1.00
R3830:Zfp729a UTSW 13 67619878 missense probably damaging 1.00
R3926:Zfp729a UTSW 13 67620191 nonsense probably null
R4134:Zfp729a UTSW 13 67619806 missense probably damaging 1.00
R4135:Zfp729a UTSW 13 67619806 missense probably damaging 1.00
R4670:Zfp729a UTSW 13 67621415 nonsense probably null
R4793:Zfp729a UTSW 13 67620427 missense probably damaging 1.00
R5009:Zfp729a UTSW 13 67620246 missense probably benign 0.01
R5125:Zfp729a UTSW 13 67637645 critical splice donor site probably null
R5178:Zfp729a UTSW 13 67637645 critical splice donor site probably null
R5438:Zfp729a UTSW 13 67619586 missense possibly damaging 0.94
R6540:Zfp729a UTSW 13 67619648 missense possibly damaging 0.81
R6731:Zfp729a UTSW 13 67620146 missense probably benign 0.09
R7001:Zfp729a UTSW 13 67620349 missense probably benign 0.31
R7626:Zfp729a UTSW 13 67620318 nonsense probably null
R7706:Zfp729a UTSW 13 67623493 missense possibly damaging 0.72
X0010:Zfp729a UTSW 13 67621782 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AATTGTAGGGTTTCTCTCCAGTG -3'
(R):5'- AACCCTACAAGTGTGAAGTGTGT -3'

Sequencing Primer
(F):5'- AGGGTTTCTCTCCAGTGTGACTTATC -3'
(R):5'- CAGTCAAGTATGTAGCAAGGCCTTC -3'
Posted On2018-11-28