Incidental Mutation 'R6987:Enc1'
ID543047
Institutional Source Beutler Lab
Gene Symbol Enc1
Ensembl Gene ENSMUSG00000041773
Gene Nameectodermal-neural cortex 1
SynonymsNrpb, PIG10
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6987 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location97241105-97253034 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 97245636 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 218 (I218T)
Ref Sequence ENSEMBL: ENSMUSP00000038783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041623]
Predicted Effect probably benign
Transcript: ENSMUST00000041623
AA Change: I218T

PolyPhen 2 Score 0.145 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000038783
Gene: ENSMUSG00000041773
AA Change: I218T

DomainStartEndE-ValueType
BTB 46 144 8.4e-32 SMART
BACK 149 251 7.5e-33 SMART
Kelch 296 340 3.89e0 SMART
Kelch 341 388 2.69e-9 SMART
Kelch 389 444 7.77e-15 SMART
Kelch 445 492 1.97e0 SMART
Kelch 493 538 2.9e-1 SMART
Kelch 539 585 1.5e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.9%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kelch-related family of actin-binding proteins. The encoded protein plays a role in the oxidative stress response as a regulator of the transcription factor Nrf2, and expression of this gene may play a role in malignant transformation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam10 A G 9: 70,722,696 I137V probably benign Het
Agtr1b A C 3: 20,316,421 I7S probably benign Het
Akt2 G T 7: 27,633,241 V215L probably damaging Het
Ccdc148 C A 2: 58,982,914 L294F probably damaging Het
Ccdc3 T A 2: 5,138,304 V124E possibly damaging Het
Cldnd1 A G 16: 58,731,371 D121G probably benign Het
Cnr1 A G 4: 33,944,739 I376V probably benign Het
Cyp2c40 A G 19: 39,812,767 probably benign Het
Dnah8 A G 17: 30,662,091 I601V possibly damaging Het
Dnhd1 C A 7: 105,704,585 H2982N probably damaging Het
Elavl4 A T 4: 110,251,405 D55E possibly damaging Het
Fbln2 T A 6: 91,234,229 V385D probably benign Het
Ffar2 A G 7: 30,819,683 V144A possibly damaging Het
Fsip2 C T 2: 82,948,286 Q159* probably null Het
Gm14548 A G 7: 3,897,661 I30T probably damaging Het
Golga4 A G 9: 118,558,532 H1574R probably benign Het
Herc2 G A 7: 56,106,453 R747H possibly damaging Het
Lama4 A G 10: 39,074,279 N985D probably benign Het
Lrp1 T C 10: 127,575,005 N1438S probably damaging Het
Masp1 C A 16: 23,513,915 V57F probably damaging Het
Mypn T C 10: 63,193,131 E51G probably benign Het
Nos1 C T 5: 117,895,785 T324M probably benign Het
Npas3 A G 12: 54,068,253 K635E possibly damaging Het
Olfr481 C A 7: 108,081,131 C112* probably null Het
Olfr870 A T 9: 20,170,834 S246T probably benign Het
Osbp2 T C 11: 3,717,958 E13G probably damaging Het
Pkd1l1 A G 11: 8,902,575 M636T probably benign Het
Pla2g4e C T 2: 120,186,380 A227T probably benign Het
Prex2 C A 1: 11,170,752 A1028E probably damaging Het
Prr14 A G 7: 127,473,805 D49G possibly damaging Het
Slc9a9 A G 9: 94,669,990 probably benign Het
Sptb A G 12: 76,613,247 C960R probably benign Het
Taf15 C A 11: 83,484,695 T31K possibly damaging Het
Tdrd9 C A 12: 112,025,593 Q601K possibly damaging Het
Tes C A 6: 17,086,155 Q16K probably benign Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Tmem168 T A 6: 13,591,477 M63L possibly damaging Het
Trav14-1 C T 14: 53,554,459 R89* probably null Het
Trp53bp2 A T 1: 182,446,635 Y615F probably damaging Het
Ttc27 T C 17: 74,777,741 probably null Het
Usp25 T A 16: 77,077,180 V548E probably damaging Het
Vmn1r124 A T 7: 21,259,818 I267K probably benign Het
Vmn1r69 A G 7: 10,580,564 M1T probably null Het
Zfp729a T A 13: 67,619,939 K724* probably null Het
Zfp850 A T 7: 27,990,001 C261S probably damaging Het
Zfp882 T A 8: 71,914,673 V448E probably benign Het
Zzef1 A G 11: 72,855,514 M881V possibly damaging Het
Other mutations in Enc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Enc1 APN 13 97245314 missense probably benign 0.00
IGL02010:Enc1 APN 13 97245080 missense possibly damaging 0.84
IGL02642:Enc1 APN 13 97245534 missense possibly damaging 0.84
IGL03342:Enc1 APN 13 97246470 missense possibly damaging 0.64
R1305:Enc1 UTSW 13 97246700 missense possibly damaging 0.58
R1419:Enc1 UTSW 13 97246184 missense probably damaging 1.00
R1733:Enc1 UTSW 13 97245042 missense possibly damaging 0.63
R1796:Enc1 UTSW 13 97246483 missense probably benign 0.00
R1796:Enc1 UTSW 13 97246485 missense possibly damaging 0.58
R1823:Enc1 UTSW 13 97245978 missense possibly damaging 0.64
R4107:Enc1 UTSW 13 97245138 missense probably damaging 1.00
R4324:Enc1 UTSW 13 97245897 missense probably benign 0.21
R4922:Enc1 UTSW 13 97245735 missense probably benign 0.08
R5942:Enc1 UTSW 13 97246379 missense probably benign 0.28
R5951:Enc1 UTSW 13 97245257 missense probably benign 0.02
R6229:Enc1 UTSW 13 97245491 missense probably benign
R6985:Enc1 UTSW 13 97245120 missense possibly damaging 0.92
R7307:Enc1 UTSW 13 97245093 missense probably damaging 1.00
R7442:Enc1 UTSW 13 97246740 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGTGCACCAAGCTGTACGAAC -3'
(R):5'- AGTTTTCCGAGGACGAGCAC -3'

Sequencing Primer
(F):5'- CTGTACGAACTCTCCTGGAGAATG -3'
(R):5'- GACCACGCCGTCATTCTGTAAG -3'
Posted On2018-11-28