Incidental Mutation 'R6987:Ticam1'
ID543053
Institutional Source Beutler Lab
Gene Symbol Ticam1
Ensembl Gene ENSMUSG00000047123
Gene Nametoll-like receptor adaptor molecule 1
SynonymsTICAM-1, Trif
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6987 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location56269319-56276786 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 56269900 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 732 (E732K)
Ref Sequence ENSEMBL: ENSMUSP00000055104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058136]
Predicted Effect probably benign
Transcript: ENSMUST00000058136
AA Change: E732K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000055104
Gene: ENSMUSG00000047123
AA Change: E732K

DomainStartEndE-ValueType
PDB:4BSX|D 5 153 3e-52 PDB
low complexity region 345 384 N/A INTRINSIC
SCOP:d1fyva_ 386 491 8e-3 SMART
PDB:2M1X|A 391 547 1e-74 PDB
Pfam:RHIM 610 698 4.7e-13 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.9%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adaptor protein containing a Toll/interleukin-1 receptor (TIR) homology domain, which is an intracellular signaling domain that mediates protein-protein interactions between the Toll-like receptors (TLRs) and signal-transduction components. This protein is involved in native immunity against invading pathogens. It specifically interacts with toll-like receptor 3, but not with other TLRs, and this association mediates dsRNA induction of interferon-beta through activation of nuclear factor kappa-B, during an antiviral immune response. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous null mice are viable but exhibit abnormalities of the innate immune system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam10 A G 9: 70,722,696 I137V probably benign Het
Agtr1b A C 3: 20,316,421 I7S probably benign Het
Akt2 G T 7: 27,633,241 V215L probably damaging Het
Ccdc148 C A 2: 58,982,914 L294F probably damaging Het
Ccdc3 T A 2: 5,138,304 V124E possibly damaging Het
Cldnd1 A G 16: 58,731,371 D121G probably benign Het
Cnr1 A G 4: 33,944,739 I376V probably benign Het
Cyp2c40 A G 19: 39,812,767 probably benign Het
Dnah8 A G 17: 30,662,091 I601V possibly damaging Het
Dnhd1 C A 7: 105,704,585 H2982N probably damaging Het
Elavl4 A T 4: 110,251,405 D55E possibly damaging Het
Enc1 T C 13: 97,245,636 I218T probably benign Het
Fbln2 T A 6: 91,234,229 V385D probably benign Het
Ffar2 A G 7: 30,819,683 V144A possibly damaging Het
Fsip2 C T 2: 82,948,286 Q159* probably null Het
Gm14548 A G 7: 3,897,661 I30T probably damaging Het
Golga4 A G 9: 118,558,532 H1574R probably benign Het
Herc2 G A 7: 56,106,453 R747H possibly damaging Het
Lama4 A G 10: 39,074,279 N985D probably benign Het
Lrp1 T C 10: 127,575,005 N1438S probably damaging Het
Masp1 C A 16: 23,513,915 V57F probably damaging Het
Mypn T C 10: 63,193,131 E51G probably benign Het
Nos1 C T 5: 117,895,785 T324M probably benign Het
Npas3 A G 12: 54,068,253 K635E possibly damaging Het
Olfr481 C A 7: 108,081,131 C112* probably null Het
Olfr870 A T 9: 20,170,834 S246T probably benign Het
Osbp2 T C 11: 3,717,958 E13G probably damaging Het
Pkd1l1 A G 11: 8,902,575 M636T probably benign Het
Pla2g4e C T 2: 120,186,380 A227T probably benign Het
Prex2 C A 1: 11,170,752 A1028E probably damaging Het
Prr14 A G 7: 127,473,805 D49G possibly damaging Het
Slc9a9 A G 9: 94,669,990 probably benign Het
Sptb A G 12: 76,613,247 C960R probably benign Het
Taf15 C A 11: 83,484,695 T31K possibly damaging Het
Tdrd9 C A 12: 112,025,593 Q601K possibly damaging Het
Tes C A 6: 17,086,155 Q16K probably benign Het
Tmem168 T A 6: 13,591,477 M63L possibly damaging Het
Trav14-1 C T 14: 53,554,459 R89* probably null Het
Trp53bp2 A T 1: 182,446,635 Y615F probably damaging Het
Ttc27 T C 17: 74,777,741 probably null Het
Usp25 T A 16: 77,077,180 V548E probably damaging Het
Vmn1r124 A T 7: 21,259,818 I267K probably benign Het
Vmn1r69 A G 7: 10,580,564 M1T probably null Het
Zfp729a T A 13: 67,619,939 K724* probably null Het
Zfp850 A T 7: 27,990,001 C261S probably damaging Het
Zfp882 T A 8: 71,914,673 V448E probably benign Het
Zzef1 A G 11: 72,855,514 M881V possibly damaging Het
Other mutations in Ticam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02160:Ticam1 APN 17 56270560 missense possibly damaging 0.80
IGL02164:Ticam1 APN 17 56270019 missense unknown
Lps2 UTSW 17 56271576 small deletion
Pangu UTSW 17 56276693 critical splice donor site probably benign
Yue UTSW 17 56271339 missense probably benign 0.06
R0930:Ticam1 UTSW 17 56270226 missense unknown
R0930:Ticam1 UTSW 17 56271687 missense probably damaging 1.00
R1509:Ticam1 UTSW 17 56271113 missense probably benign 0.43
R1837:Ticam1 UTSW 17 56270799 missense possibly damaging 0.87
R1863:Ticam1 UTSW 17 56271436 missense probably damaging 1.00
R1867:Ticam1 UTSW 17 56271718 missense probably benign 0.01
R1872:Ticam1 UTSW 17 56271897 missense probably benign 0.00
R1893:Ticam1 UTSW 17 56271894 missense probably benign 0.36
R1980:Ticam1 UTSW 17 56271555 missense probably damaging 0.99
R1981:Ticam1 UTSW 17 56271555 missense probably damaging 0.99
R1982:Ticam1 UTSW 17 56271555 missense probably damaging 0.99
R2263:Ticam1 UTSW 17 56271888 missense possibly damaging 0.95
R2513:Ticam1 UTSW 17 56271612 missense possibly damaging 0.61
R4294:Ticam1 UTSW 17 56271339 missense probably benign 0.06
R4888:Ticam1 UTSW 17 56271642 missense probably damaging 0.98
R4982:Ticam1 UTSW 17 56272020 missense probably benign 0.10
R5396:Ticam1 UTSW 17 56271117 missense probably benign 0.02
R5604:Ticam1 UTSW 17 56271756 missense probably benign 0.13
R5641:Ticam1 UTSW 17 56270629 frame shift probably null
R5647:Ticam1 UTSW 17 56270629 frame shift probably null
R5648:Ticam1 UTSW 17 56270629 frame shift probably null
R5657:Ticam1 UTSW 17 56270629 frame shift probably null
R5770:Ticam1 UTSW 17 56270629 frame shift probably null
R5771:Ticam1 UTSW 17 56270629 frame shift probably null
R5964:Ticam1 UTSW 17 56271703 missense probably damaging 0.99
R5974:Ticam1 UTSW 17 56271178 missense probably benign
R6217:Ticam1 UTSW 17 56270730 missense probably damaging 1.00
R6983:Ticam1 UTSW 17 56269900 missense probably benign 0.00
R6984:Ticam1 UTSW 17 56269900 missense probably benign 0.00
R6985:Ticam1 UTSW 17 56269900 missense probably benign 0.00
R6986:Ticam1 UTSW 17 56269900 missense probably benign 0.00
R6988:Ticam1 UTSW 17 56269900 missense probably benign 0.00
R6989:Ticam1 UTSW 17 56269900 missense probably benign 0.00
R7029:Ticam1 UTSW 17 56271154 missense possibly damaging 0.51
R7684:Ticam1 UTSW 17 56269984 missense unknown
R7755:Ticam1 UTSW 17 56270182 missense unknown
R7885:Ticam1 UTSW 17 56271067 missense probably benign 0.04
R8021:Ticam1 UTSW 17 56270089 missense unknown
R8414:Ticam1 UTSW 17 56271340 missense probably benign 0.00
R8822:Ticam1 UTSW 17 56271444 missense probably damaging 1.00
V8831:Ticam1 UTSW 17 56269969 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GGTCTCAAGCTGGGTCCAAC -3'
(R):5'- TCCTCAGGGTGGTACTCCAG -3'

Sequencing Primer
(F):5'- TGGGTCCAACTAATAGCCACTGTG -3'
(R):5'- CAGGGTGGTACTCCAGTTTTCC -3'
Posted On2018-11-28