Incidental Mutation 'R6988:Slc27a3'
ID543064
Institutional Source Beutler Lab
Gene Symbol Slc27a3
Ensembl Gene ENSMUSG00000027932
Gene Namesolute carrier family 27 (fatty acid transporter), member 3
SynonymsAcsvl3, fatty acid transport protein 3, FATP3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R6988 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location90385239-90389938 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 90386290 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 596 (N596S)
Ref Sequence ENSEMBL: ENSMUSP00000029541 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029541]
Predicted Effect probably benign
Transcript: ENSMUST00000029541
AA Change: N596S

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000029541
Gene: ENSMUSG00000027932
AA Change: N596S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 38 56 N/A INTRINSIC
Pfam:AMP-binding 138 535 9.2e-62 PFAM
Pfam:AMP-binding_C 543 619 9.6e-9 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000122599
Gene: ENSMUSG00000027932
AA Change: N561S

DomainStartEndE-ValueType
low complexity region 40 64 N/A INTRINSIC
low complexity region 68 89 N/A INTRINSIC
low complexity region 91 106 N/A INTRINSIC
Pfam:AMP-binding 147 501 5.3e-50 PFAM
Pfam:AMP-binding_C 509 585 2.9e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a family of integral membrane proteins and encodes a protein that is involved in lipid metabolism. The increased expression of this gene in human neural stem cells derived from induced pluripotent stem cells suggests that it plays an important role in early brain development. Naturally occurring mutations in this gene are associated with autism spectrum disorders. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik T G 4: 137,454,579 L15W probably damaging Het
4930550C14Rik G A 9: 53,411,756 V31I possibly damaging Het
4932415D10Rik T C 10: 82,291,899 D1759G possibly damaging Het
Adgre1 C T 17: 57,408,445 S255F probably benign Het
Aff4 T G 11: 53,398,237 S404R probably damaging Het
Akr1c19 A T 13: 4,233,758 probably benign Het
Ankrd31 T A 13: 96,878,249 I1342K probably damaging Het
Arhgap5 T A 12: 52,518,125 D626E possibly damaging Het
Arhgef1 G A 7: 24,916,923 V332I probably benign Het
AY358078 A G 14: 51,826,187 E430G probably damaging Het
B4gat1 T A 19: 5,040,434 I395N probably benign Het
Bub1b T A 2: 118,636,830 I878N probably damaging Het
Ccdc150 C T 1: 54,355,709 Q745* probably null Het
Ccl19 A T 4: 42,754,885 I87N probably damaging Het
Ces2g G C 8: 104,963,908 G107A probably benign Het
Chpt1 A G 10: 88,488,406 V180A probably damaging Het
Col2a1 T C 15: 98,004,454 T14A unknown Het
Dnah7a T C 1: 53,582,625 I1114V possibly damaging Het
Dnah7c T C 1: 46,666,213 I2462T possibly damaging Het
Dnah8 T C 17: 30,643,275 F208S probably damaging Het
Dnhd1 A G 7: 105,714,210 E3993G probably damaging Het
Erv3 C T 2: 131,855,966 D158N possibly damaging Het
Exoc6 T A 19: 37,609,091 F647I probably damaging Het
Fbrs G A 7: 127,479,508 probably benign Het
Fgfr1op2 T C 6: 146,589,965 F109L probably damaging Het
Fv1 T C 4: 147,869,271 F98S possibly damaging Het
Gm436 A G 4: 144,686,325 F15S probably benign Het
H2-M10.1 T C 17: 36,325,592 K107E probably benign Het
Hspg2 A T 4: 137,528,890 Q1436L probably damaging Het
Ighv1-74 T C 12: 115,802,763 Y79C probably damaging Het
Kcnj1 G A 9: 32,396,585 V102I probably benign Het
Mnt C A 11: 74,842,809 probably benign Het
Mrpl15 T C 1: 4,782,660 T112A probably benign Het
Ncdn T C 4: 126,747,189 D506G probably benign Het
Ogdh C T 11: 6,313,806 R81* probably null Het
Olfr791 T A 10: 129,526,673 S149T probably benign Het
Olfr815 G C 10: 129,902,409 F100L probably damaging Het
Pole G T 5: 110,329,583 V1863F probably damaging Het
Pramel5 T C 4: 144,274,007 probably benign Het
Rabep1 A G 11: 70,934,537 K636E probably damaging Het
Rasgrf2 T A 13: 91,885,635 Y1151F probably benign Het
Rrad A G 8: 104,630,636 V93A probably damaging Het
Sesn3 A T 9: 14,310,257 R118* probably null Het
Snx19 C A 9: 30,428,935 D456E probably damaging Het
Supt20 T C 3: 54,698,597 S35P probably damaging Het
Syde2 G T 3: 146,019,809 R885L probably benign Het
Synm G A 7: 67,733,658 L1419F probably damaging Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Tekt2 A G 4: 126,323,443 F221L probably benign Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Tmem39b A G 4: 129,693,148 I90T possibly damaging Het
Trib2 A G 12: 15,815,338 S79P probably damaging Het
Usp32 T C 11: 85,010,143 M1084V probably benign Het
Vmn1r181 T C 7: 23,984,847 F246L probably damaging Het
Wnt16 A G 6: 22,288,511 D2G probably damaging Het
Zfp462 A G 4: 55,080,716 E1357G probably benign Het
Zhx3 A G 2: 160,779,868 M793T probably benign Het
Other mutations in Slc27a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Slc27a3 APN 3 90385441 nonsense probably null
IGL01080:Slc27a3 APN 3 90385460 missense probably benign 0.17
IGL01313:Slc27a3 APN 3 90386554 missense probably damaging 1.00
IGL01358:Slc27a3 APN 3 90386552 missense probably damaging 1.00
IGL02261:Slc27a3 APN 3 90387695 missense probably benign
R0557:Slc27a3 UTSW 3 90386856 missense probably damaging 1.00
R1922:Slc27a3 UTSW 3 90386317 missense probably benign
R2032:Slc27a3 UTSW 3 90387397 missense probably damaging 0.99
R3922:Slc27a3 UTSW 3 90387085 missense possibly damaging 0.65
R4278:Slc27a3 UTSW 3 90389188 unclassified probably benign
R4432:Slc27a3 UTSW 3 90387340 missense probably damaging 0.99
R4433:Slc27a3 UTSW 3 90387340 missense probably damaging 0.99
R4672:Slc27a3 UTSW 3 90387646 missense possibly damaging 0.90
R5183:Slc27a3 UTSW 3 90389170 critical splice donor site probably null
R5201:Slc27a3 UTSW 3 90389219 missense probably benign 0.41
R5328:Slc27a3 UTSW 3 90386832 missense probably damaging 1.00
R5405:Slc27a3 UTSW 3 90387075 missense probably benign 0.05
R5477:Slc27a3 UTSW 3 90386839 missense probably benign
R5743:Slc27a3 UTSW 3 90387072 missense probably benign 0.38
R6344:Slc27a3 UTSW 3 90387654 nonsense probably null
R6450:Slc27a3 UTSW 3 90385470 missense probably damaging 0.97
R7204:Slc27a3 UTSW 3 90389726 missense probably benign 0.07
R7736:Slc27a3 UTSW 3 90389433 missense probably benign 0.22
R8045:Slc27a3 UTSW 3 90387142 missense probably damaging 0.99
R8046:Slc27a3 UTSW 3 90389667 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGAGCATGCGCCAATCAG -3'
(R):5'- CTTCCTTCAGGAGGTGAACATCTATG -3'

Sequencing Primer
(F):5'- AATCAGGGGAGCGTCCTTC -3'
(R):5'- AACATCTATGGAGTCACGGTGCC -3'
Posted On2018-11-28