Incidental Mutation 'R6988:Ncdn'
ID543069
Institutional Source Beutler Lab
Gene Symbol Ncdn
Ensembl Gene ENSMUSG00000028833
Gene Nameneurochondrin
Synonymsnorbin, neurochondrin-1, neurochondrin-2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6988 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location126743750-126753438 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 126747189 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 506 (D506G)
Ref Sequence ENSEMBL: ENSMUSP00000101722 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030637] [ENSMUST00000106116]
Predicted Effect probably benign
Transcript: ENSMUST00000030637
AA Change: D506G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000030637
Gene: ENSMUSG00000028833
AA Change: D506G

DomainStartEndE-ValueType
Pfam:Neurochondrin 30 637 3e-209 PFAM
low complexity region 649 659 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106116
AA Change: D506G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000101722
Gene: ENSMUSG00000028833
AA Change: D506G

DomainStartEndE-ValueType
Pfam:Neurochondrin 30 637 9.1e-217 PFAM
low complexity region 649 659 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a leucine-rich cytoplasmic protein, which is highly similar to a mouse protein that negatively regulates Ca/calmodulin-dependent protein kinase II phosphorylation and may be essential for spatial learning processes. Several alternatively spliced transcript variants of this gene have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted inactivation of this gene results in early embryonic lethality in the homozygous state and impaired chondrocyte proliferation and differentiation in the heterozygous state. Gene trap mutation resulted in lacrimal gland hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik T G 4: 137,454,579 L15W probably damaging Het
4930550C14Rik G A 9: 53,411,756 V31I possibly damaging Het
4932415D10Rik T C 10: 82,291,899 D1759G possibly damaging Het
Adgre1 C T 17: 57,408,445 S255F probably benign Het
Aff4 T G 11: 53,398,237 S404R probably damaging Het
Akr1c19 A T 13: 4,233,758 probably benign Het
Ankrd31 T A 13: 96,878,249 I1342K probably damaging Het
Arhgap5 T A 12: 52,518,125 D626E possibly damaging Het
Arhgef1 G A 7: 24,916,923 V332I probably benign Het
AY358078 A G 14: 51,826,187 E430G probably damaging Het
B4gat1 T A 19: 5,040,434 I395N probably benign Het
Bub1b T A 2: 118,636,830 I878N probably damaging Het
Ccdc150 C T 1: 54,355,709 Q745* probably null Het
Ccl19 A T 4: 42,754,885 I87N probably damaging Het
Ces2g G C 8: 104,963,908 G107A probably benign Het
Chpt1 A G 10: 88,488,406 V180A probably damaging Het
Col2a1 T C 15: 98,004,454 T14A unknown Het
Dnah7a T C 1: 53,582,625 I1114V possibly damaging Het
Dnah7c T C 1: 46,666,213 I2462T possibly damaging Het
Dnah8 T C 17: 30,643,275 F208S probably damaging Het
Dnhd1 A G 7: 105,714,210 E3993G probably damaging Het
Erv3 C T 2: 131,855,966 D158N possibly damaging Het
Exoc6 T A 19: 37,609,091 F647I probably damaging Het
Fbrs G A 7: 127,479,508 probably benign Het
Fgfr1op2 T C 6: 146,589,965 F109L probably damaging Het
Fv1 T C 4: 147,869,271 F98S possibly damaging Het
Gm436 A G 4: 144,686,325 F15S probably benign Het
H2-M10.1 T C 17: 36,325,592 K107E probably benign Het
Hspg2 A T 4: 137,528,890 Q1436L probably damaging Het
Ighv1-74 T C 12: 115,802,763 Y79C probably damaging Het
Kcnj1 G A 9: 32,396,585 V102I probably benign Het
Mnt C A 11: 74,842,809 probably benign Het
Mrpl15 T C 1: 4,782,660 T112A probably benign Het
Ogdh C T 11: 6,313,806 R81* probably null Het
Olfr791 T A 10: 129,526,673 S149T probably benign Het
Olfr815 G C 10: 129,902,409 F100L probably damaging Het
Pole G T 5: 110,329,583 V1863F probably damaging Het
Pramel5 T C 4: 144,274,007 probably benign Het
Rabep1 A G 11: 70,934,537 K636E probably damaging Het
Rasgrf2 T A 13: 91,885,635 Y1151F probably benign Het
Rrad A G 8: 104,630,636 V93A probably damaging Het
Sesn3 A T 9: 14,310,257 R118* probably null Het
Slc27a3 T C 3: 90,386,290 N596S probably benign Het
Snx19 C A 9: 30,428,935 D456E probably damaging Het
Supt20 T C 3: 54,698,597 S35P probably damaging Het
Syde2 G T 3: 146,019,809 R885L probably benign Het
Synm G A 7: 67,733,658 L1419F probably damaging Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Tekt2 A G 4: 126,323,443 F221L probably benign Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Tmem39b A G 4: 129,693,148 I90T possibly damaging Het
Trib2 A G 12: 15,815,338 S79P probably damaging Het
Usp32 T C 11: 85,010,143 M1084V probably benign Het
Vmn1r181 T C 7: 23,984,847 F246L probably damaging Het
Wnt16 A G 6: 22,288,511 D2G probably damaging Het
Zfp462 A G 4: 55,080,716 E1357G probably benign Het
Zhx3 A G 2: 160,779,868 M793T probably benign Het
Other mutations in Ncdn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ncdn APN 4 126747188 missense probably benign 0.00
R0031:Ncdn UTSW 4 126750108 splice site probably null
R0135:Ncdn UTSW 4 126746669 missense probably benign 0.37
R0413:Ncdn UTSW 4 126750534 missense possibly damaging 0.52
R1404:Ncdn UTSW 4 126750040 missense probably benign 0.33
R1404:Ncdn UTSW 4 126750040 missense probably benign 0.33
R1486:Ncdn UTSW 4 126748598 missense probably damaging 1.00
R1533:Ncdn UTSW 4 126748698 nonsense probably null
R1785:Ncdn UTSW 4 126745273 critical splice acceptor site probably null
R1786:Ncdn UTSW 4 126745273 critical splice acceptor site probably null
R1789:Ncdn UTSW 4 126752003 missense probably damaging 1.00
R1791:Ncdn UTSW 4 126751939 critical splice donor site probably null
R3406:Ncdn UTSW 4 126748595 missense probably benign 0.09
R4547:Ncdn UTSW 4 126746674 missense probably damaging 1.00
R4863:Ncdn UTSW 4 126750423 missense probably damaging 1.00
R4916:Ncdn UTSW 4 126749938 missense possibly damaging 0.89
R4917:Ncdn UTSW 4 126749938 missense possibly damaging 0.89
R4918:Ncdn UTSW 4 126749938 missense possibly damaging 0.89
R5218:Ncdn UTSW 4 126750810 missense probably benign 0.13
R5356:Ncdn UTSW 4 126747228 missense probably damaging 1.00
R5617:Ncdn UTSW 4 126745047 missense probably damaging 0.99
R5718:Ncdn UTSW 4 126749950 nonsense probably null
R6057:Ncdn UTSW 4 126745031 missense probably benign 0.05
R6343:Ncdn UTSW 4 126747171 missense possibly damaging 0.74
R6986:Ncdn UTSW 4 126747229 missense probably damaging 1.00
R8257:Ncdn UTSW 4 126749883 critical splice donor site probably null
R8279:Ncdn UTSW 4 126750406 missense probably benign 0.00
Z1176:Ncdn UTSW 4 126750151 missense probably damaging 1.00
Z1176:Ncdn UTSW 4 126750153 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TTATGCTAACATTCAGCCTACGGC -3'
(R):5'- TTTCAGTCAGGGTGCTCTGC -3'

Sequencing Primer
(F):5'- CTACGGCTACAGGGAAACTAAGTC -3'
(R):5'- GGGTGCTCTGCCCTTATC -3'
Posted On2018-11-28