Incidental Mutation 'R6988:Tmem39b'
ID 543070
Institutional Source Beutler Lab
Gene Symbol Tmem39b
Ensembl Gene ENSMUSG00000053730
Gene Name transmembrane protein 39b
Synonyms 6330509E05Rik
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.298) question?
Stock # R6988 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 129570148-129590631 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 129586941 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 90 (I90T)
Ref Sequence ENSEMBL: ENSMUSP00000120048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102588] [ENSMUST00000125445] [ENSMUST00000137640] [ENSMUST00000147668]
AlphaFold Q810L4
Predicted Effect possibly damaging
Transcript: ENSMUST00000102588
AA Change: I90T

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099648
Gene: ENSMUSG00000053730
AA Change: I90T

DomainStartEndE-ValueType
Pfam:Tmp39 48 478 1.6e-207 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000125445
AA Change: I90T

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000121505
Gene: ENSMUSG00000053730
AA Change: I90T

DomainStartEndE-ValueType
Pfam:Tmp39 46 122 3.6e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137640
SMART Domains Protein: ENSMUSP00000115156
Gene: ENSMUSG00000053730

DomainStartEndE-ValueType
Pfam:Tmp39 1 70 1e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000147668
AA Change: I90T

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000120048
Gene: ENSMUSG00000053730
AA Change: I90T

DomainStartEndE-ValueType
Pfam:Tmp39 46 121 6.8e-32 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik T G 4: 137,181,890 (GRCm39) L15W probably damaging Het
4930550C14Rik G A 9: 53,323,056 (GRCm39) V31I possibly damaging Het
Aadacl4fm4 A G 4: 144,412,895 (GRCm39) F15S probably benign Het
Adgre1 C T 17: 57,715,445 (GRCm39) S255F probably benign Het
Aff4 T G 11: 53,289,064 (GRCm39) S404R probably damaging Het
Akr1c19 A T 13: 4,283,757 (GRCm39) probably benign Het
Ankrd31 T A 13: 97,014,757 (GRCm39) I1342K probably damaging Het
Arhgap5 T A 12: 52,564,908 (GRCm39) D626E possibly damaging Het
Arhgef1 G A 7: 24,616,348 (GRCm39) V332I probably benign Het
AY358078 A G 14: 52,063,644 (GRCm39) E430G probably damaging Het
B4gat1 T A 19: 5,090,462 (GRCm39) I395N probably benign Het
Bub1b T A 2: 118,467,311 (GRCm39) I878N probably damaging Het
Ccdc150 C T 1: 54,394,868 (GRCm39) Q745* probably null Het
Ccl19 A T 4: 42,754,885 (GRCm39) I87N probably damaging Het
Ces2g G C 8: 105,690,540 (GRCm39) G107A probably benign Het
Chpt1 A G 10: 88,324,268 (GRCm39) V180A probably damaging Het
Col2a1 T C 15: 97,902,335 (GRCm39) T14A unknown Het
Dnah7a T C 1: 53,621,784 (GRCm39) I1114V possibly damaging Het
Dnah7c T C 1: 46,705,373 (GRCm39) I2462T possibly damaging Het
Dnah8 T C 17: 30,862,249 (GRCm39) F208S probably damaging Het
Dnhd1 A G 7: 105,363,417 (GRCm39) E3993G probably damaging Het
Erv3 C T 2: 131,697,886 (GRCm39) D158N possibly damaging Het
Exoc6 T A 19: 37,597,539 (GRCm39) F647I probably damaging Het
Fbrs G A 7: 127,078,680 (GRCm39) probably benign Het
Fgfr1op2 T C 6: 146,491,463 (GRCm39) F109L probably damaging Het
Fv1 T C 4: 147,953,728 (GRCm39) F98S possibly damaging Het
H2-M10.1 T C 17: 36,636,484 (GRCm39) K107E probably benign Het
Hspg2 A T 4: 137,256,201 (GRCm39) Q1436L probably damaging Het
Ighv1-74 T C 12: 115,766,383 (GRCm39) Y79C probably damaging Het
Kcnj1 G A 9: 32,307,881 (GRCm39) V102I probably benign Het
Mnt C A 11: 74,733,635 (GRCm39) probably benign Het
Mrpl15 T C 1: 4,852,883 (GRCm39) T112A probably benign Het
Ncdn T C 4: 126,640,982 (GRCm39) D506G probably benign Het
Ogdh C T 11: 6,263,806 (GRCm39) R81* probably null Het
Or6c2 T A 10: 129,362,542 (GRCm39) S149T probably benign Het
Or6c217 G C 10: 129,738,278 (GRCm39) F100L probably damaging Het
Pole G T 5: 110,477,449 (GRCm39) V1863F probably damaging Het
Pramel5 T C 4: 144,000,577 (GRCm39) probably benign Het
Rabep1 A G 11: 70,825,363 (GRCm39) K636E probably damaging Het
Rasgrf2 T A 13: 92,033,754 (GRCm39) Y1151F probably benign Het
Rrad A G 8: 105,357,268 (GRCm39) V93A probably damaging Het
Sesn3 A T 9: 14,221,553 (GRCm39) R118* probably null Het
Slc27a3 T C 3: 90,293,597 (GRCm39) N596S probably benign Het
Snx19 C A 9: 30,340,231 (GRCm39) D456E probably damaging Het
Spata31h1 T C 10: 82,127,733 (GRCm39) D1759G possibly damaging Het
Supt20 T C 3: 54,606,018 (GRCm39) S35P probably damaging Het
Syde2 G T 3: 145,725,564 (GRCm39) R885L probably benign Het
Synm G A 7: 67,383,406 (GRCm39) L1419F probably damaging Het
Tekt2 A G 4: 126,217,236 (GRCm39) F221L probably benign Het
Ticam1 C T 17: 56,576,900 (GRCm39) E732K probably benign Het
Trgv6 G T 13: 19,374,814 (GRCm39) G40W possibly damaging Het
Trib2 A G 12: 15,865,339 (GRCm39) S79P probably damaging Het
Usp32 T C 11: 84,900,969 (GRCm39) M1084V probably benign Het
Vmn1r181 T C 7: 23,684,272 (GRCm39) F246L probably damaging Het
Wnt16 A G 6: 22,288,510 (GRCm39) D2G probably damaging Het
Zfp462 A G 4: 55,080,716 (GRCm39) E1357G probably benign Het
Zhx3 A G 2: 160,621,788 (GRCm39) M793T probably benign Het
Other mutations in Tmem39b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02215:Tmem39b APN 4 129,586,311 (GRCm39) critical splice acceptor site probably null
IGL02423:Tmem39b APN 4 129,572,442 (GRCm39) missense probably damaging 1.00
PIT4514001:Tmem39b UTSW 4 129,578,290 (GRCm39) missense possibly damaging 0.48
R0502:Tmem39b UTSW 4 129,580,779 (GRCm39) missense possibly damaging 0.95
R0503:Tmem39b UTSW 4 129,580,779 (GRCm39) missense possibly damaging 0.95
R1483:Tmem39b UTSW 4 129,570,456 (GRCm39) missense probably damaging 1.00
R1522:Tmem39b UTSW 4 129,578,275 (GRCm39) missense probably benign 0.30
R1612:Tmem39b UTSW 4 129,580,715 (GRCm39) missense possibly damaging 0.70
R1751:Tmem39b UTSW 4 129,586,976 (GRCm39) missense possibly damaging 0.95
R1767:Tmem39b UTSW 4 129,586,976 (GRCm39) missense possibly damaging 0.95
R1771:Tmem39b UTSW 4 129,587,011 (GRCm39) missense probably damaging 0.99
R2140:Tmem39b UTSW 4 129,572,481 (GRCm39) missense probably benign 0.30
R2202:Tmem39b UTSW 4 129,587,716 (GRCm39) missense probably benign 0.03
R2204:Tmem39b UTSW 4 129,587,716 (GRCm39) missense probably benign 0.03
R2205:Tmem39b UTSW 4 129,587,716 (GRCm39) missense probably benign 0.03
R6176:Tmem39b UTSW 4 129,586,894 (GRCm39) missense probably damaging 1.00
R6247:Tmem39b UTSW 4 129,580,584 (GRCm39) missense possibly damaging 0.69
R6551:Tmem39b UTSW 4 129,585,896 (GRCm39) missense probably benign
R6654:Tmem39b UTSW 4 129,580,619 (GRCm39) missense probably damaging 1.00
R6934:Tmem39b UTSW 4 129,572,366 (GRCm39) missense possibly damaging 0.51
R7614:Tmem39b UTSW 4 129,587,694 (GRCm39) missense probably damaging 1.00
R8129:Tmem39b UTSW 4 129,572,468 (GRCm39) missense probably damaging 0.99
R8708:Tmem39b UTSW 4 129,570,191 (GRCm39) unclassified probably benign
R9249:Tmem39b UTSW 4 129,572,468 (GRCm39) missense probably damaging 0.99
X0024:Tmem39b UTSW 4 129,578,240 (GRCm39) missense possibly damaging 0.94
Z1088:Tmem39b UTSW 4 129,586,270 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TATGCCCATTATGGAGCGGG -3'
(R):5'- GTTCCAGAAGCTTCTCCTGG -3'

Sequencing Primer
(F):5'- CCCATTATGGAGCGGGGTATTG -3'
(R):5'- AGAAGCTTCTCCTGGTCGGG -3'
Posted On 2018-11-28