Mutagenetix > Incidental Mutation

Incidental Mutation 'R6988:Pole'

543076

Institutional Source

Beutler Lab

Gene Symbol

Pole

Ensembl Gene

ENSMUSG00000007080

Gene Name

polymerase (DNA directed), epsilon

Synonyms

pol-epsilon

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6988 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

110286306-110337474 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 110329583 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Phenylalanine at position 1863 (V1863F)

Ref Sequence

ENSEMBL: ENSMUSP00000007296 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000007296] [ENSMUST00000112481]

AlphaFold

Q9WVF7

Predicted Effect

probably damaging
Transcript: ENSMUST00000007296
AA Change: V1863F

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000007296
Gene: ENSMUSG00000007080
AA Change: V1863F

Domain	Start	End	E-Value	Type
POLBc	267	870	9.42e-97	SMART
Blast:POLBc	903	970	1e-28	BLAST
Blast:POLBc	1014	1073	2e-22	BLAST
Blast:POLBc	1195	1266	7e-21	BLAST
low complexity region	1275	1294	N/A	INTRINSIC
Blast:DUF1744	1401	1430	2e-7	BLAST
DUF1744	1524	1924	1.9e-236	SMART
coiled coil region	1936	1963	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000112481

SMART Domains

Protein: ENSMUSP00000108100
Gene: ENSMUSG00000007080

Domain	Start	End	E-Value	Type
Pfam:DUF1744	13	48	2.7e-13	PFAM
coiled coil region	60	87	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the catalytic subunit of DNA polymerase epsilon. The enzyme is involved in DNA repair and chromosomal DNA replication. Mutations in this gene have been associated with colorectal cancer 12 and facial dysmorphism, immunodeficiency, livedo, and short stature. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit increased incidence of tumors and premature death. Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700013G24Rik	T	G	4: 137,454,579	L15W	probably damaging	Het
4930550C14Rik	G	A	9: 53,411,756	V31I	possibly damaging	Het
4932415D10Rik	T	C	10: 82,291,899	D1759G	possibly damaging	Het
Adgre1	C	T	17: 57,408,445	S255F	probably benign	Het
Aff4	T	G	11: 53,398,237	S404R	probably damaging	Het
Akr1c19	A	T	13: 4,233,758		probably benign	Het
Ankrd31	T	A	13: 96,878,249	I1342K	probably damaging	Het
Arhgap5	T	A	12: 52,518,125	D626E	possibly damaging	Het
Arhgef1	G	A	7: 24,916,923	V332I	probably benign	Het
AY358078	A	G	14: 51,826,187	E430G	probably damaging	Het
B4gat1	T	A	19: 5,040,434	I395N	probably benign	Het
Bub1b	T	A	2: 118,636,830	I878N	probably damaging	Het
Ccdc150	C	T	1: 54,355,709	Q745*	probably null	Het
Ccl19	A	T	4: 42,754,885	I87N	probably damaging	Het
Ces2g	G	C	8: 104,963,908	G107A	probably benign	Het
Chpt1	A	G	10: 88,488,406	V180A	probably damaging	Het
Col2a1	T	C	15: 98,004,454	T14A	unknown	Het
Dnah7a	T	C	1: 53,582,625	I1114V	possibly damaging	Het
Dnah7c	T	C	1: 46,666,213	I2462T	possibly damaging	Het
Dnah8	T	C	17: 30,643,275	F208S	probably damaging	Het
Dnhd1	A	G	7: 105,714,210	E3993G	probably damaging	Het
Erv3	C	T	2: 131,855,966	D158N	possibly damaging	Het
Exoc6	T	A	19: 37,609,091	F647I	probably damaging	Het
Fbrs	G	A	7: 127,479,508		probably benign	Het
Fgfr1op2	T	C	6: 146,589,965	F109L	probably damaging	Het
Fv1	T	C	4: 147,869,271	F98S	possibly damaging	Het
Gm436	A	G	4: 144,686,325	F15S	probably benign	Het
H2-M10.1	T	C	17: 36,325,592	K107E	probably benign	Het
Hspg2	A	T	4: 137,528,890	Q1436L	probably damaging	Het
Ighv1-74	T	C	12: 115,802,763	Y79C	probably damaging	Het
Kcnj1	G	A	9: 32,396,585	V102I	probably benign	Het
Mnt	C	A	11: 74,842,809		probably benign	Het
Mrpl15	T	C	1: 4,782,660	T112A	probably benign	Het
Ncdn	T	C	4: 126,747,189	D506G	probably benign	Het
Ogdh	C	T	11: 6,313,806	R81*	probably null	Het
Olfr791	T	A	10: 129,526,673	S149T	probably benign	Het
Olfr815	G	C	10: 129,902,409	F100L	probably damaging	Het
Pramel5	T	C	4: 144,274,007		probably benign	Het
Rabep1	A	G	11: 70,934,537	K636E	probably damaging	Het
Rasgrf2	T	A	13: 91,885,635	Y1151F	probably benign	Het
Rrad	A	G	8: 104,630,636	V93A	probably damaging	Het
Sesn3	A	T	9: 14,310,257	R118*	probably null	Het
Slc27a3	T	C	3: 90,386,290	N596S	probably benign	Het
Snx19	C	A	9: 30,428,935	D456E	probably damaging	Het
Supt20	T	C	3: 54,698,597	S35P	probably damaging	Het
Syde2	G	T	3: 146,019,809	R885L	probably benign	Het
Synm	G	A	7: 67,733,658	L1419F	probably damaging	Het
Tcrg-V6	G	T	13: 19,190,644	G40W	possibly damaging	Het
Tekt2	A	G	4: 126,323,443	F221L	probably benign	Het
Ticam1	C	T	17: 56,269,900	E732K	probably benign	Het
Tmem39b	A	G	4: 129,693,148	I90T	possibly damaging	Het
Trib2	A	G	12: 15,815,338	S79P	probably damaging	Het
Usp32	T	C	11: 85,010,143	M1084V	probably benign	Het
Vmn1r181	T	C	7: 23,984,847	F246L	probably damaging	Het
Wnt16	A	G	6: 22,288,511	D2G	probably damaging	Het
Zfp462	A	G	4: 55,080,716	E1357G	probably benign	Het
Zhx3	A	G	2: 160,779,868	M793T	probably benign	Het

Other mutations in Pole

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00418:Pole	APN	5	110303565	splice site	probably benign
IGL00475:Pole	APN	5	110291096	nonsense	probably null
IGL00837:Pole	APN	5	110302009	missense	possibly damaging	0.91
IGL00976:Pole	APN	5	110323572	missense	probably benign	0.00
IGL01081:Pole	APN	5	110337240	missense	possibly damaging	0.92
IGL01503:Pole	APN	5	110303884	missense	probably damaging	1.00
IGL01640:Pole	APN	5	110298266	missense	probably null	0.08
IGL01987:Pole	APN	5	110337232	missense	probably benign	0.01
IGL02429:Pole	APN	5	110299800	missense	probably benign
IGL02733:Pole	APN	5	110312728	splice site	probably benign
IGL03102:Pole	APN	5	110297073	missense	probably damaging	1.00
IGL03157:Pole	APN	5	110293753	missense	probably benign
IGL03186:Pole	APN	5	110299920	critical splice donor site	probably null
IGL03271:Pole	APN	5	110318319	missense	probably benign
IGL03351:Pole	APN	5	110301998	splice site	probably benign
IGL03408:Pole	APN	5	110294560	missense	probably damaging	1.00
IGL03410:Pole	APN	5	110324559	missense	probably benign
ANU74:Pole	UTSW	5	110289370	missense	probably benign	0.44
PIT4495001:Pole	UTSW	5	110303914	missense	probably damaging	1.00
R0053:Pole	UTSW	5	110293340	missense	probably damaging	1.00
R0053:Pole	UTSW	5	110293340	missense	probably damaging	1.00
R0124:Pole	UTSW	5	110303992	missense	probably damaging	0.96
R0145:Pole	UTSW	5	110324425	missense	probably damaging	0.99
R0523:Pole	UTSW	5	110303593	missense	probably damaging	0.96
R0590:Pole	UTSW	5	110317926	missense	probably benign
R0625:Pole	UTSW	5	110325550	missense	possibly damaging	0.50
R0707:Pole	UTSW	5	110298988	missense	probably damaging	1.00
R1160:Pole	UTSW	5	110295253	missense	possibly damaging	0.85
R1320:Pole	UTSW	5	110309129	frame shift	probably null
R1384:Pole	UTSW	5	110323664	missense	possibly damaging	0.81
R1626:Pole	UTSW	5	110293369	missense	probably benign	0.25
R1643:Pole	UTSW	5	110317845	missense	probably damaging	1.00
R1655:Pole	UTSW	5	110335922	missense	probably damaging	1.00
R1668:Pole	UTSW	5	110297369	missense	probably damaging	1.00
R1783:Pole	UTSW	5	110297430	missense	probably damaging	1.00
R1843:Pole	UTSW	5	110330835	critical splice donor site	probably null
R1853:Pole	UTSW	5	110306853	missense	possibly damaging	0.95
R1867:Pole	UTSW	5	110334197	missense	probably benign	0.08
R1874:Pole	UTSW	5	110323664	missense	possibly damaging	0.81
R1891:Pole	UTSW	5	110332542	missense	probably damaging	1.00
R1928:Pole	UTSW	5	110327778	missense	probably benign
R2073:Pole	UTSW	5	110325551	missense	probably damaging	0.99
R2341:Pole	UTSW	5	110330963	missense	possibly damaging	0.67
R2448:Pole	UTSW	5	110297092	missense	probably damaging	1.00
R2504:Pole	UTSW	5	110290502	splice site	probably null
R3053:Pole	UTSW	5	110289795	missense	probably damaging	1.00
R3892:Pole	UTSW	5	110336439	missense	probably damaging	1.00
R3964:Pole	UTSW	5	110312782	missense	probably damaging	1.00
R3965:Pole	UTSW	5	110312782	missense	probably damaging	1.00
R4374:Pole	UTSW	5	110337205	missense	possibly damaging	0.89
R4376:Pole	UTSW	5	110337205	missense	possibly damaging	0.89
R4377:Pole	UTSW	5	110337205	missense	possibly damaging	0.89
R4520:Pole	UTSW	5	110297924	missense	probably damaging	1.00
R4670:Pole	UTSW	5	110306387	missense	probably benign	0.01
R4778:Pole	UTSW	5	110330832	missense	probably benign	0.00
R4887:Pole	UTSW	5	110324753	missense	probably damaging	0.99
R4898:Pole	UTSW	5	110290224	critical splice acceptor site	probably null
R5184:Pole	UTSW	5	110294934	missense	possibly damaging	0.91
R5359:Pole	UTSW	5	110332488	missense	probably benign	0.03
R5483:Pole	UTSW	5	110294568	missense	probably damaging	1.00
R5529:Pole	UTSW	5	110332466	missense	probably benign	0.20
R5576:Pole	UTSW	5	110312065	nonsense	probably null
R5817:Pole	UTSW	5	110312972	missense	probably damaging	1.00
R5877:Pole	UTSW	5	110332463	missense	probably benign
R5956:Pole	UTSW	5	110337287	unclassified	probably benign
R5990:Pole	UTSW	5	110302144	missense	probably damaging	1.00
R6019:Pole	UTSW	5	110324514	missense	probably benign	0.01
R6019:Pole	UTSW	5	110324515	missense	probably benign	0.01
R6093:Pole	UTSW	5	110312090	missense	probably benign	0.01
R6376:Pole	UTSW	5	110336374	missense	probably damaging	0.99
R6494:Pole	UTSW	5	110324722	missense	possibly damaging	0.86
R6535:Pole	UTSW	5	110324807	missense	probably damaging	1.00
R6723:Pole	UTSW	5	110323616	missense	probably benign	0.11
R6757:Pole	UTSW	5	110303610	missense	probably damaging	1.00
R6930:Pole	UTSW	5	110293290	missense	probably benign	0.01
R6992:Pole	UTSW	5	110332499	missense	probably damaging	0.99
R7067:Pole	UTSW	5	110334218	missense	probably damaging	1.00
R7097:Pole	UTSW	5	110325102	splice site	probably null
R7122:Pole	UTSW	5	110325102	splice site	probably null
R7202:Pole	UTSW	5	110297107	missense	possibly damaging	0.94
R7340:Pole	UTSW	5	110334464	missense	probably benign	0.06
R7345:Pole	UTSW	5	110303903	missense	possibly damaging	0.82
R7509:Pole	UTSW	5	110330705	start gained	probably benign
R7557:Pole	UTSW	5	110312994	missense	probably damaging	1.00
R7740:Pole	UTSW	5	110331041	missense	probably benign	0.00
R7792:Pole	UTSW	5	110297466	splice site	probably null
R7832:Pole	UTSW	5	110317797	missense	probably benign	0.00
R7849:Pole	UTSW	5	110332548	missense	probably benign	0.04
R7852:Pole	UTSW	5	110306829	missense	probably damaging	1.00
R7960:Pole	UTSW	5	110289861	missense	possibly damaging	0.81
R8001:Pole	UTSW	5	110312734	missense	probably damaging	1.00
R8266:Pole	UTSW	5	110294920	missense	probably damaging	1.00
R8510:Pole	UTSW	5	110334446	missense	probably damaging	0.99
R8793:Pole	UTSW	5	110297748	missense	probably damaging	1.00
R8835:Pole	UTSW	5	110306909	missense	probably damaging	1.00
R8863:Pole	UTSW	5	110289367	missense	possibly damaging	0.94
R8929:Pole	UTSW	5	110297788	missense	probably damaging	0.98
R8968:Pole	UTSW	5	110312083	missense	possibly damaging	0.78
R8992:Pole	UTSW	5	110323622	missense	possibly damaging	0.88
R9018:Pole	UTSW	5	110289809	missense	probably benign	0.37
R9177:Pole	UTSW	5	110332422	missense	probably benign	0.04
R9250:Pole	UTSW	5	110299821	missense	possibly damaging	0.88
R9262:Pole	UTSW	5	110325556	missense	probably damaging	0.99
R9262:Pole	UTSW	5	110325557	missense	probably damaging	1.00
R9367:Pole	UTSW	5	110297089	missense	probably damaging	0.99
R9383:Pole	UTSW	5	110291026	missense	possibly damaging	0.61
X0064:Pole	UTSW	5	110317904	nonsense	probably null
Y5377:Pole	UTSW	5	110294891	critical splice acceptor site	probably null
Y5380:Pole	UTSW	5	110294891	critical splice acceptor site	probably null
Z1088:Pole	UTSW	5	110327865	missense	possibly damaging	0.66
Z1177:Pole	UTSW	5	110297009	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCTCATTCTAAGCATAGTTGGG -3'
(R):5'- ACCCTGGGTGTGATTTCTTC -3'

Sequencing Primer
(F):5'- CATCAGATCCCATGACAGGTAGTTG -3'
(R):5'- ACCCTGGGTGTGATTTCTTCATCAG -3'

Posted On

2018-11-28