Incidental Mutation 'R6988:Arhgef1'
ID543080
Institutional Source Beutler Lab
Gene Symbol Arhgef1
Ensembl Gene ENSMUSG00000040940
Gene NameRho guanine nucleotide exchange factor (GEF) 1
SynonymsLbcl2, Lsc
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.432) question?
Stock #R6988 (G1)
Quality Score192.009
Status Not validated
Chromosome7
Chromosomal Location24902912-24926594 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 24916923 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 332 (V332I)
Ref Sequence ENSEMBL: ENSMUSP00000113771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047873] [ENSMUST00000098683] [ENSMUST00000117419] [ENSMUST00000117796] [ENSMUST00000132751] [ENSMUST00000151121] [ENSMUST00000205295] [ENSMUST00000206011] [ENSMUST00000206508] [ENSMUST00000206906]
Predicted Effect probably benign
Transcript: ENSMUST00000047873
AA Change: V332I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000046469
Gene: ENSMUSG00000040940
AA Change: V332I

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:RGS-like 40 230 1.3e-72 PFAM
low complexity region 380 400 N/A INTRINSIC
RhoGEF 419 603 1.87e-63 SMART
PH 647 761 4.68e-5 SMART
low complexity region 845 864 N/A INTRINSIC
coiled coil region 867 890 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098683
AA Change: V331I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000096280
Gene: ENSMUSG00000040940
AA Change: V331I

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:RGS-like 40 230 2.2e-78 PFAM
PDB:3ODW|B 238 384 2e-57 PDB
low complexity region 396 412 N/A INTRINSIC
low complexity region 439 459 N/A INTRINSIC
RhoGEF 478 662 1.87e-63 SMART
PH 706 820 4.68e-5 SMART
low complexity region 904 923 N/A INTRINSIC
coiled coil region 926 949 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117419
AA Change: V332I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113366
Gene: ENSMUSG00000040940
AA Change: V332I

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:RGS-like 40 230 1.3e-72 PFAM
low complexity region 380 400 N/A INTRINSIC
RhoGEF 419 603 1.87e-63 SMART
PH 647 761 4.68e-5 SMART
low complexity region 845 864 N/A INTRINSIC
coiled coil region 867 890 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117796
AA Change: V332I

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000113771
Gene: ENSMUSG00000040940
AA Change: V332I

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:RGS-like 40 230 7.3e-73 PFAM
low complexity region 393 409 N/A INTRINSIC
low complexity region 436 456 N/A INTRINSIC
RhoGEF 475 659 1.87e-63 SMART
PH 703 817 4.68e-5 SMART
low complexity region 901 920 N/A INTRINSIC
coiled coil region 923 946 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000132751
SMART Domains Protein: ENSMUSP00000117008
Gene: ENSMUSG00000040940

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 70 89 N/A INTRINSIC
low complexity region 97 113 N/A INTRINSIC
low complexity region 140 160 N/A INTRINSIC
RhoGEF 179 363 1.87e-63 SMART
PH 407 521 4.68e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151121
SMART Domains Protein: ENSMUSP00000114388
Gene: ENSMUSG00000040940

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:RGS-like 40 101 5.3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205295
Predicted Effect probably benign
Transcript: ENSMUST00000206011
Predicted Effect probably benign
Transcript: ENSMUST00000206508
AA Change: V331I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000206906
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form complex with G proteins and stimulate Rho-dependent signals. Multiple alternatively spliced transcript variants have been found for this gene, but the full-length nature of some variants has not been defined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in impaired humeral immunity, reduced numbers of marginal zone B (MZB) cells, decreased basal T cell proliferation, and reduced basal motility of lymphocytes but enhanced migration of MZB cells after serum activation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik T G 4: 137,454,579 L15W probably damaging Het
4930550C14Rik G A 9: 53,411,756 V31I possibly damaging Het
4932415D10Rik T C 10: 82,291,899 D1759G possibly damaging Het
Adgre1 C T 17: 57,408,445 S255F probably benign Het
Aff4 T G 11: 53,398,237 S404R probably damaging Het
Akr1c19 A T 13: 4,233,758 probably benign Het
Ankrd31 T A 13: 96,878,249 I1342K probably damaging Het
Arhgap5 T A 12: 52,518,125 D626E possibly damaging Het
AY358078 A G 14: 51,826,187 E430G probably damaging Het
B4gat1 T A 19: 5,040,434 I395N probably benign Het
Bub1b T A 2: 118,636,830 I878N probably damaging Het
Ccdc150 C T 1: 54,355,709 Q745* probably null Het
Ccl19 A T 4: 42,754,885 I87N probably damaging Het
Ces2g G C 8: 104,963,908 G107A probably benign Het
Chpt1 A G 10: 88,488,406 V180A probably damaging Het
Col2a1 T C 15: 98,004,454 T14A unknown Het
Dnah7a T C 1: 53,582,625 I1114V possibly damaging Het
Dnah7c T C 1: 46,666,213 I2462T possibly damaging Het
Dnah8 T C 17: 30,643,275 F208S probably damaging Het
Dnhd1 A G 7: 105,714,210 E3993G probably damaging Het
Erv3 C T 2: 131,855,966 D158N possibly damaging Het
Exoc6 T A 19: 37,609,091 F647I probably damaging Het
Fbrs G A 7: 127,479,508 probably benign Het
Fgfr1op2 T C 6: 146,589,965 F109L probably damaging Het
Fv1 T C 4: 147,869,271 F98S possibly damaging Het
Gm436 A G 4: 144,686,325 F15S probably benign Het
H2-M10.1 T C 17: 36,325,592 K107E probably benign Het
Hspg2 A T 4: 137,528,890 Q1436L probably damaging Het
Ighv1-74 T C 12: 115,802,763 Y79C probably damaging Het
Kcnj1 G A 9: 32,396,585 V102I probably benign Het
Mnt C A 11: 74,842,809 probably benign Het
Mrpl15 T C 1: 4,782,660 T112A probably benign Het
Ncdn T C 4: 126,747,189 D506G probably benign Het
Ogdh C T 11: 6,313,806 R81* probably null Het
Olfr791 T A 10: 129,526,673 S149T probably benign Het
Olfr815 G C 10: 129,902,409 F100L probably damaging Het
Pole G T 5: 110,329,583 V1863F probably damaging Het
Pramel5 T C 4: 144,274,007 probably benign Het
Rabep1 A G 11: 70,934,537 K636E probably damaging Het
Rasgrf2 T A 13: 91,885,635 Y1151F probably benign Het
Rrad A G 8: 104,630,636 V93A probably damaging Het
Sesn3 A T 9: 14,310,257 R118* probably null Het
Slc27a3 T C 3: 90,386,290 N596S probably benign Het
Snx19 C A 9: 30,428,935 D456E probably damaging Het
Supt20 T C 3: 54,698,597 S35P probably damaging Het
Syde2 G T 3: 146,019,809 R885L probably benign Het
Synm G A 7: 67,733,658 L1419F probably damaging Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Tekt2 A G 4: 126,323,443 F221L probably benign Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Tmem39b A G 4: 129,693,148 I90T possibly damaging Het
Trib2 A G 12: 15,815,338 S79P probably damaging Het
Usp32 T C 11: 85,010,143 M1084V probably benign Het
Vmn1r181 T C 7: 23,984,847 F246L probably damaging Het
Wnt16 A G 6: 22,288,511 D2G probably damaging Het
Zfp462 A G 4: 55,080,716 E1357G probably benign Het
Zhx3 A G 2: 160,779,868 M793T probably benign Het
Other mutations in Arhgef1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Arhgef1 APN 7 24908359 missense possibly damaging 0.93
IGL00901:Arhgef1 APN 7 24912693 missense probably damaging 1.00
IGL01139:Arhgef1 APN 7 24925951 unclassified probably benign
IGL01479:Arhgef1 APN 7 24912603 missense probably benign 0.01
IGL01935:Arhgef1 APN 7 24921882 missense probably damaging 1.00
IGL01944:Arhgef1 APN 7 24925783 critical splice acceptor site probably null
IGL02032:Arhgef1 APN 7 24923371 missense probably benign 0.23
IGL02059:Arhgef1 APN 7 24912552 splice site probably benign
IGL02202:Arhgef1 APN 7 24913429 nonsense probably null
IGL02324:Arhgef1 APN 7 24923815 missense probably damaging 1.00
IGL02328:Arhgef1 APN 7 24923815 missense probably damaging 1.00
IGL03027:Arhgef1 APN 7 24923732 missense probably damaging 0.98
IGL03227:Arhgef1 APN 7 24922851 missense probably damaging 1.00
IGL03404:Arhgef1 APN 7 24916843 missense probably benign 0.07
BB009:Arhgef1 UTSW 7 24919710 missense probably damaging 1.00
BB019:Arhgef1 UTSW 7 24919710 missense probably damaging 1.00
R0082:Arhgef1 UTSW 7 24912605 nonsense probably null
R0277:Arhgef1 UTSW 7 24923799 unclassified probably benign
R0336:Arhgef1 UTSW 7 24921957 missense possibly damaging 0.77
R0494:Arhgef1 UTSW 7 24919360 intron probably benign
R0668:Arhgef1 UTSW 7 24907920 missense possibly damaging 0.63
R1520:Arhgef1 UTSW 7 24919704 missense probably damaging 1.00
R1531:Arhgef1 UTSW 7 24924998 missense probably damaging 0.99
R1656:Arhgef1 UTSW 7 24913632 missense probably damaging 1.00
R2979:Arhgef1 UTSW 7 24907751 missense unknown
R3855:Arhgef1 UTSW 7 24919272 missense probably damaging 1.00
R3856:Arhgef1 UTSW 7 24919272 missense probably damaging 1.00
R4080:Arhgef1 UTSW 7 24925846 missense probably damaging 0.96
R4081:Arhgef1 UTSW 7 24925846 missense probably damaging 0.96
R4583:Arhgef1 UTSW 7 24912571 missense probably benign 0.09
R4750:Arhgef1 UTSW 7 24918576 intron probably benign
R4914:Arhgef1 UTSW 7 24923839 missense probably damaging 1.00
R5255:Arhgef1 UTSW 7 24925022 missense probably damaging 1.00
R5275:Arhgef1 UTSW 7 24919352 critical splice donor site probably null
R5295:Arhgef1 UTSW 7 24919352 critical splice donor site probably null
R5430:Arhgef1 UTSW 7 24912307 splice site probably null
R5604:Arhgef1 UTSW 7 24912785 missense probably benign 0.09
R6150:Arhgef1 UTSW 7 24919357 splice site probably null
R6151:Arhgef1 UTSW 7 24917942 missense probably benign 0.00
R6788:Arhgef1 UTSW 7 24919780 splice site probably null
R6943:Arhgef1 UTSW 7 24923731 missense probably benign 0.01
R7422:Arhgef1 UTSW 7 24916036 missense probably benign 0.00
R7701:Arhgef1 UTSW 7 24912578 missense probably benign 0.01
R7706:Arhgef1 UTSW 7 24916881 missense probably damaging 1.00
R7707:Arhgef1 UTSW 7 24916881 missense probably damaging 1.00
R7708:Arhgef1 UTSW 7 24916881 missense probably damaging 1.00
R7932:Arhgef1 UTSW 7 24919710 missense probably damaging 1.00
R7967:Arhgef1 UTSW 7 24916881 missense probably damaging 1.00
R7970:Arhgef1 UTSW 7 24916881 missense probably damaging 1.00
R7995:Arhgef1 UTSW 7 24919216 missense probably damaging 0.99
R8029:Arhgef1 UTSW 7 24919738 missense probably damaging 1.00
R8132:Arhgef1 UTSW 7 24907662 intron probably benign
R8132:Arhgef1 UTSW 7 24919749 nonsense probably null
R8168:Arhgef1 UTSW 7 24925406 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AGAGCACAGTGTCATAGTTCTCC -3'
(R):5'- TCAGAGCCCAAAGGGTAAAC -3'

Sequencing Primer
(F):5'- CATAGTTCTCCTGGATGCAGTAGC -3'
(R):5'- CCCAAAGGGTAAACTAAGGCAGC -3'
Posted On2018-11-28