Incidental Mutation 'R6988:Synm'
ID 543081
Institutional Source Beutler Lab
Gene Symbol Synm
Ensembl Gene ENSMUSG00000030554
Gene Name synemin, intermediate filament protein
Synonyms 4930412K21Rik, Dmn, Synemin
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6988 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 67730160-67759742 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 67733658 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 1419 (L1419F)
Ref Sequence ENSEMBL: ENSMUSP00000073855 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051389] [ENSMUST00000074233] [ENSMUST00000207102] [ENSMUST00000208231] [ENSMUST00000208815]
AlphaFold Q70IV5
Predicted Effect probably benign
Transcript: ENSMUST00000051389
SMART Domains Protein: ENSMUSP00000050987
Gene: ENSMUSG00000030554

DomainStartEndE-ValueType
Pfam:Filament 10 321 2.7e-38 PFAM
low complexity region 1248 1257 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000074233
AA Change: L1419F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000073855
Gene: ENSMUSG00000030554
AA Change: L1419F

DomainStartEndE-ValueType
Filament 10 321 6.4e-38 SMART
internal_repeat_1 1089 1185 3.03e-7 PROSPERO
internal_repeat_1 1351 1454 3.03e-7 PROSPERO
low complexity region 1550 1559 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207102
Predicted Effect probably benign
Transcript: ENSMUST00000208231
Predicted Effect probably benign
Transcript: ENSMUST00000208764
Predicted Effect probably benign
Transcript: ENSMUST00000208815
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an intermediate filament (IF) family member. IF proteins are cytoskeletal proteins that confer resistance to mechanical stress and are encoded by a dispersed multigene family. This protein has been found to form a linkage between desmin, which is a subunit of the IF network, and the extracellular matrix, and provides an important structural support in muscle. Two alternatively spliced variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a mild skeletal muscle phenotype characterized by abnormal muscle fiber morphology and increased sarcolemmal deformability and susceptibility to injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik T G 4: 137,454,579 L15W probably damaging Het
4930550C14Rik G A 9: 53,411,756 V31I possibly damaging Het
4932415D10Rik T C 10: 82,291,899 D1759G possibly damaging Het
Adgre1 C T 17: 57,408,445 S255F probably benign Het
Aff4 T G 11: 53,398,237 S404R probably damaging Het
Akr1c19 A T 13: 4,233,758 probably benign Het
Ankrd31 T A 13: 96,878,249 I1342K probably damaging Het
Arhgap5 T A 12: 52,518,125 D626E possibly damaging Het
Arhgef1 G A 7: 24,916,923 V332I probably benign Het
AY358078 A G 14: 51,826,187 E430G probably damaging Het
B4gat1 T A 19: 5,040,434 I395N probably benign Het
Bub1b T A 2: 118,636,830 I878N probably damaging Het
Ccdc150 C T 1: 54,355,709 Q745* probably null Het
Ccl19 A T 4: 42,754,885 I87N probably damaging Het
Ces2g G C 8: 104,963,908 G107A probably benign Het
Chpt1 A G 10: 88,488,406 V180A probably damaging Het
Col2a1 T C 15: 98,004,454 T14A unknown Het
Dnah7a T C 1: 53,582,625 I1114V possibly damaging Het
Dnah7c T C 1: 46,666,213 I2462T possibly damaging Het
Dnah8 T C 17: 30,643,275 F208S probably damaging Het
Dnhd1 A G 7: 105,714,210 E3993G probably damaging Het
Erv3 C T 2: 131,855,966 D158N possibly damaging Het
Exoc6 T A 19: 37,609,091 F647I probably damaging Het
Fbrs G A 7: 127,479,508 probably benign Het
Fgfr1op2 T C 6: 146,589,965 F109L probably damaging Het
Fv1 T C 4: 147,869,271 F98S possibly damaging Het
Gm436 A G 4: 144,686,325 F15S probably benign Het
H2-M10.1 T C 17: 36,325,592 K107E probably benign Het
Hspg2 A T 4: 137,528,890 Q1436L probably damaging Het
Ighv1-74 T C 12: 115,802,763 Y79C probably damaging Het
Kcnj1 G A 9: 32,396,585 V102I probably benign Het
Mnt C A 11: 74,842,809 probably benign Het
Mrpl15 T C 1: 4,782,660 T112A probably benign Het
Ncdn T C 4: 126,747,189 D506G probably benign Het
Ogdh C T 11: 6,313,806 R81* probably null Het
Olfr791 T A 10: 129,526,673 S149T probably benign Het
Olfr815 G C 10: 129,902,409 F100L probably damaging Het
Pole G T 5: 110,329,583 V1863F probably damaging Het
Pramel5 T C 4: 144,274,007 probably benign Het
Rabep1 A G 11: 70,934,537 K636E probably damaging Het
Rasgrf2 T A 13: 91,885,635 Y1151F probably benign Het
Rrad A G 8: 104,630,636 V93A probably damaging Het
Sesn3 A T 9: 14,310,257 R118* probably null Het
Slc27a3 T C 3: 90,386,290 N596S probably benign Het
Snx19 C A 9: 30,428,935 D456E probably damaging Het
Supt20 T C 3: 54,698,597 S35P probably damaging Het
Syde2 G T 3: 146,019,809 R885L probably benign Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Tekt2 A G 4: 126,323,443 F221L probably benign Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Tmem39b A G 4: 129,693,148 I90T possibly damaging Het
Trib2 A G 12: 15,815,338 S79P probably damaging Het
Usp32 T C 11: 85,010,143 M1084V probably benign Het
Vmn1r181 T C 7: 23,984,847 F246L probably damaging Het
Wnt16 A G 6: 22,288,511 D2G probably damaging Het
Zfp462 A G 4: 55,080,716 E1357G probably benign Het
Zhx3 A G 2: 160,779,868 M793T probably benign Het
Other mutations in Synm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Synm APN 7 67734915 missense probably benign 0.01
IGL01567:Synm APN 7 67735232 missense probably damaging 0.99
IGL01867:Synm APN 7 67733474 missense probably benign 0.13
IGL01870:Synm APN 7 67736118 missense possibly damaging 0.86
IGL01951:Synm APN 7 67739137 missense probably damaging 1.00
IGL02264:Synm APN 7 67734396 missense probably damaging 0.99
IGL02892:Synm APN 7 67735056 missense probably damaging 1.00
PIT4449001:Synm UTSW 7 67735277 missense probably benign
R0032:Synm UTSW 7 67733927 missense possibly damaging 0.90
R0194:Synm UTSW 7 67734924 missense probably damaging 1.00
R0345:Synm UTSW 7 67735821 missense probably benign 0.13
R0453:Synm UTSW 7 67736882 missense possibly damaging 0.92
R0646:Synm UTSW 7 67759168 missense probably benign 0.07
R0847:Synm UTSW 7 67735056 missense probably damaging 1.00
R0919:Synm UTSW 7 67735347 missense probably damaging 1.00
R1484:Synm UTSW 7 67736332 missense probably damaging 1.00
R1700:Synm UTSW 7 67759628 start codon destroyed probably null 0.98
R1715:Synm UTSW 7 67736303 missense probably damaging 1.00
R1796:Synm UTSW 7 67734000 missense possibly damaging 0.77
R1799:Synm UTSW 7 67735959 missense probably damaging 1.00
R2116:Synm UTSW 7 67733595 missense probably benign 0.18
R2979:Synm UTSW 7 67736260 missense probably damaging 1.00
R4116:Synm UTSW 7 67734657 missense possibly damaging 0.50
R4172:Synm UTSW 7 67735361 missense probably damaging 1.00
R4981:Synm UTSW 7 67734487 missense probably benign 0.02
R5114:Synm UTSW 7 67735658 missense probably damaging 1.00
R5276:Synm UTSW 7 67734689 missense probably benign 0.08
R5446:Synm UTSW 7 67735974 missense probably benign 0.17
R5592:Synm UTSW 7 67759516 missense probably damaging 1.00
R5960:Synm UTSW 7 67735746 missense probably damaging 1.00
R6025:Synm UTSW 7 67734938 missense possibly damaging 0.78
R6034:Synm UTSW 7 67734905 missense probably damaging 1.00
R6034:Synm UTSW 7 67734905 missense probably damaging 1.00
R6445:Synm UTSW 7 67733645 missense probably benign
R6446:Synm UTSW 7 67734966 missense probably damaging 1.00
R6492:Synm UTSW 7 67736061 missense probably benign 0.00
R6526:Synm UTSW 7 67735583 missense possibly damaging 0.62
R6612:Synm UTSW 7 67733516 missense probably damaging 0.99
R6646:Synm UTSW 7 67735127 missense probably damaging 1.00
R6708:Synm UTSW 7 67733246 missense possibly damaging 0.72
R6957:Synm UTSW 7 67736100 missense probably benign 0.28
R7208:Synm UTSW 7 67734915 missense probably benign 0.01
R7320:Synm UTSW 7 67735380 missense possibly damaging 0.89
R7417:Synm UTSW 7 67733206 makesense probably null
R7425:Synm UTSW 7 67733446 missense probably damaging 0.99
R7468:Synm UTSW 7 67733223 missense unknown
R7733:Synm UTSW 7 67735945 splice site probably null
R7782:Synm UTSW 7 67734966 missense probably damaging 1.00
R7826:Synm UTSW 7 67735589 missense probably damaging 1.00
R7971:Synm UTSW 7 67735235 missense possibly damaging 0.74
R8177:Synm UTSW 7 67734065 missense probably benign 0.00
R8190:Synm UTSW 7 67733906 missense probably benign
R8225:Synm UTSW 7 67759049 missense probably benign 0.16
R8414:Synm UTSW 7 67733763 missense probably benign 0.12
R8880:Synm UTSW 7 67736708 missense possibly damaging 0.84
R8978:Synm UTSW 7 67734924 missense probably damaging 1.00
R9027:Synm UTSW 7 67734692 missense probably damaging 1.00
R9089:Synm UTSW 7 67759018 missense probably damaging 0.97
R9281:Synm UTSW 7 67736300 nonsense probably null
R9430:Synm UTSW 7 67733433 missense possibly damaging 0.95
Z1088:Synm UTSW 7 67751886 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGCAATTCTCCAGCCACC -3'
(R):5'- TCCAGGCCACTCACAATTTC -3'

Sequencing Primer
(F):5'- TGAGACACGCCGTGAGCTTC -3'
(R):5'- ACTCACAATTTCACCTCAGATAGAG -3'
Posted On 2018-11-28