Incidental Mutation 'R6988:Ces2g'
ID543085
Institutional Source Beutler Lab
Gene Symbol Ces2g
Ensembl Gene ENSMUSG00000031877
Gene Namecarboxylesterase 2G
Synonyms2210023G05Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.048) question?
Stock #R6988 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location104961718-104969537 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 104963908 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Alanine at position 107 (G107A)
Ref Sequence ENSEMBL: ENSMUSP00000049315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043183] [ENSMUST00000212820]
Predicted Effect probably benign
Transcript: ENSMUST00000043183
AA Change: G107A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000049315
Gene: ENSMUSG00000031877
AA Change: G107A

DomainStartEndE-ValueType
Pfam:COesterase 11 539 1.4e-176 PFAM
Pfam:Abhydrolase_3 144 245 4.9e-11 PFAM
Pfam:Peptidase_S9 159 331 8.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212820
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik T G 4: 137,454,579 L15W probably damaging Het
4930550C14Rik G A 9: 53,411,756 V31I possibly damaging Het
4932415D10Rik T C 10: 82,291,899 D1759G possibly damaging Het
Adgre1 C T 17: 57,408,445 S255F probably benign Het
Aff4 T G 11: 53,398,237 S404R probably damaging Het
Akr1c19 A T 13: 4,233,758 probably benign Het
Ankrd31 T A 13: 96,878,249 I1342K probably damaging Het
Arhgap5 T A 12: 52,518,125 D626E possibly damaging Het
Arhgef1 G A 7: 24,916,923 V332I probably benign Het
AY358078 A G 14: 51,826,187 E430G probably damaging Het
B4gat1 T A 19: 5,040,434 I395N probably benign Het
Bub1b T A 2: 118,636,830 I878N probably damaging Het
Ccdc150 C T 1: 54,355,709 Q745* probably null Het
Ccl19 A T 4: 42,754,885 I87N probably damaging Het
Chpt1 A G 10: 88,488,406 V180A probably damaging Het
Col2a1 T C 15: 98,004,454 T14A unknown Het
Dnah7a T C 1: 53,582,625 I1114V possibly damaging Het
Dnah7c T C 1: 46,666,213 I2462T possibly damaging Het
Dnah8 T C 17: 30,643,275 F208S probably damaging Het
Dnhd1 A G 7: 105,714,210 E3993G probably damaging Het
Erv3 C T 2: 131,855,966 D158N possibly damaging Het
Exoc6 T A 19: 37,609,091 F647I probably damaging Het
Fbrs G A 7: 127,479,508 probably benign Het
Fgfr1op2 T C 6: 146,589,965 F109L probably damaging Het
Fv1 T C 4: 147,869,271 F98S possibly damaging Het
Gm436 A G 4: 144,686,325 F15S probably benign Het
H2-M10.1 T C 17: 36,325,592 K107E probably benign Het
Hspg2 A T 4: 137,528,890 Q1436L probably damaging Het
Ighv1-74 T C 12: 115,802,763 Y79C probably damaging Het
Kcnj1 G A 9: 32,396,585 V102I probably benign Het
Mnt C A 11: 74,842,809 probably benign Het
Mrpl15 T C 1: 4,782,660 T112A probably benign Het
Ncdn T C 4: 126,747,189 D506G probably benign Het
Ogdh C T 11: 6,313,806 R81* probably null Het
Olfr791 T A 10: 129,526,673 S149T probably benign Het
Olfr815 G C 10: 129,902,409 F100L probably damaging Het
Pole G T 5: 110,329,583 V1863F probably damaging Het
Pramel5 T C 4: 144,274,007 probably benign Het
Rabep1 A G 11: 70,934,537 K636E probably damaging Het
Rasgrf2 T A 13: 91,885,635 Y1151F probably benign Het
Rrad A G 8: 104,630,636 V93A probably damaging Het
Sesn3 A T 9: 14,310,257 R118* probably null Het
Slc27a3 T C 3: 90,386,290 N596S probably benign Het
Snx19 C A 9: 30,428,935 D456E probably damaging Het
Supt20 T C 3: 54,698,597 S35P probably damaging Het
Syde2 G T 3: 146,019,809 R885L probably benign Het
Synm G A 7: 67,733,658 L1419F probably damaging Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Tekt2 A G 4: 126,323,443 F221L probably benign Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Tmem39b A G 4: 129,693,148 I90T possibly damaging Het
Trib2 A G 12: 15,815,338 S79P probably damaging Het
Usp32 T C 11: 85,010,143 M1084V probably benign Het
Vmn1r181 T C 7: 23,984,847 F246L probably damaging Het
Wnt16 A G 6: 22,288,511 D2G probably damaging Het
Zfp462 A G 4: 55,080,716 E1357G probably benign Het
Zhx3 A G 2: 160,779,868 M793T probably benign Het
Other mutations in Ces2g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00832:Ces2g APN 8 104967839 splice site probably benign
IGL00901:Ces2g APN 8 104965129 missense probably benign 0.01
IGL02101:Ces2g APN 8 104965137 splice site probably null
IGL02146:Ces2g APN 8 104966944 missense possibly damaging 0.94
IGL02624:Ces2g APN 8 104964748 missense probably damaging 1.00
IGL03091:Ces2g APN 8 104964754 missense probably damaging 1.00
PIT4810001:Ces2g UTSW 8 104964889 missense possibly damaging 0.52
R0025:Ces2g UTSW 8 104965996 splice site probably benign
R0025:Ces2g UTSW 8 104965996 splice site probably benign
R0122:Ces2g UTSW 8 104968300 missense probably damaging 0.96
R0494:Ces2g UTSW 8 104966567 missense probably benign
R1127:Ces2g UTSW 8 104967462 splice site probably null
R1337:Ces2g UTSW 8 104963965 missense possibly damaging 0.63
R1619:Ces2g UTSW 8 104967352 missense probably damaging 1.00
R1813:Ces2g UTSW 8 104966937 missense probably benign 0.32
R2240:Ces2g UTSW 8 104962502 missense probably benign 0.11
R2255:Ces2g UTSW 8 104967414 missense probably damaging 1.00
R2307:Ces2g UTSW 8 104968412 missense probably benign 0.01
R2566:Ces2g UTSW 8 104965989 critical splice donor site probably null
R4026:Ces2g UTSW 8 104964745 missense probably damaging 0.99
R4469:Ces2g UTSW 8 104965970 missense probably benign 0.14
R4631:Ces2g UTSW 8 104967462 splice site probably null
R4859:Ces2g UTSW 8 104967462 splice site probably null
R4900:Ces2g UTSW 8 104967357 nonsense probably null
R4925:Ces2g UTSW 8 104964894 missense probably benign 0.27
R5524:Ces2g UTSW 8 104966895 missense probably benign 0.00
R5556:Ces2g UTSW 8 104967442 missense probably benign 0.14
R6795:Ces2g UTSW 8 104967817 missense probably damaging 0.96
R7653:Ces2g UTSW 8 104962653 missense probably damaging 1.00
R7724:Ces2g UTSW 8 104966852 missense probably benign 0.02
R7740:Ces2g UTSW 8 104966330 missense probably damaging 0.98
R7856:Ces2g UTSW 8 104966382 missense not run
R8123:Ces2g UTSW 8 104966923 missense probably benign 0.06
Z1177:Ces2g UTSW 8 104963961 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGCTGCCCTAGAAATCTG -3'
(R):5'- AAACTCAGGTTGCTTTTGTCCC -3'

Sequencing Primer
(F):5'- AGCTTTCACTGAGCCTATGG -3'
(R):5'- AGGTTGCTTTTGTCCCTTCTAAC -3'
Posted On2018-11-28