Mutagenetix > Incidental Mutations

Incidental Mutation 'R6988:Snx19'

543087

Institutional Source

Beutler Lab

Gene Symbol

Snx19

Ensembl Gene

ENSMUSG00000031993

Gene Name

sorting nexin 19

Synonyms

3526401K03Rik

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.105) question?

Stock #

R6988 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

30427108-30466733 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 30428935 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 456 (D456E)

Ref Sequence

ENSEMBL: ENSMUSP00000131895 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000164099]

AlphaFold

Q6P4T1

Predicted Effect

probably damaging
Transcript: ENSMUST00000164099
AA Change: D456E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000131895
Gene: ENSMUSG00000031993
AA Change: D456E

Domain	Start	End	E-Value	Type
transmembrane domain	29	46	N/A	INTRINSIC
transmembrane domain	51	73	N/A	INTRINSIC
Pfam:PXA	96	269	2.9e-43	PFAM
low complexity region	324	335	N/A	INTRINSIC
low complexity region	371	385	N/A	INTRINSIC
low complexity region	504	528	N/A	INTRINSIC
PX	533	664	1.83e-24	SMART
Pfam:Nexin_C	843	951	1.9e-23	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Islet antigen-2 (IA-2) is an autoantigen in type 1 diabetes and plays a role in insulin secretion. IA-2 is found in dense-core secretory vesicles and interacts with the product of this gene, a sorting nexin. In mouse pancreatic beta-cells, the encoded protein influenced insulin secretion by stabilizing the number of dense-core secretory vesicles. [provided by RefSeq, Dec 2016]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700013G24Rik	T	G	4: 137,454,579	L15W	probably damaging	Het
4930550C14Rik	G	A	9: 53,411,756	V31I	possibly damaging	Het
4932415D10Rik	T	C	10: 82,291,899	D1759G	possibly damaging	Het
Adgre1	C	T	17: 57,408,445	S255F	probably benign	Het
Aff4	T	G	11: 53,398,237	S404R	probably damaging	Het
Akr1c19	A	T	13: 4,233,758		probably benign	Het
Ankrd31	T	A	13: 96,878,249	I1342K	probably damaging	Het
Arhgap5	T	A	12: 52,518,125	D626E	possibly damaging	Het
Arhgef1	G	A	7: 24,916,923	V332I	probably benign	Het
AY358078	A	G	14: 51,826,187	E430G	probably damaging	Het
B4gat1	T	A	19: 5,040,434	I395N	probably benign	Het
Bub1b	T	A	2: 118,636,830	I878N	probably damaging	Het
Ccdc150	C	T	1: 54,355,709	Q745*	probably null	Het
Ccl19	A	T	4: 42,754,885	I87N	probably damaging	Het
Ces2g	G	C	8: 104,963,908	G107A	probably benign	Het
Chpt1	A	G	10: 88,488,406	V180A	probably damaging	Het
Col2a1	T	C	15: 98,004,454	T14A	unknown	Het
Dnah7a	T	C	1: 53,582,625	I1114V	possibly damaging	Het
Dnah7c	T	C	1: 46,666,213	I2462T	possibly damaging	Het
Dnah8	T	C	17: 30,643,275	F208S	probably damaging	Het
Dnhd1	A	G	7: 105,714,210	E3993G	probably damaging	Het
Erv3	C	T	2: 131,855,966	D158N	possibly damaging	Het
Exoc6	T	A	19: 37,609,091	F647I	probably damaging	Het
Fbrs	G	A	7: 127,479,508		probably benign	Het
Fgfr1op2	T	C	6: 146,589,965	F109L	probably damaging	Het
Fv1	T	C	4: 147,869,271	F98S	possibly damaging	Het
Gm436	A	G	4: 144,686,325	F15S	probably benign	Het
H2-M10.1	T	C	17: 36,325,592	K107E	probably benign	Het
Hspg2	A	T	4: 137,528,890	Q1436L	probably damaging	Het
Ighv1-74	T	C	12: 115,802,763	Y79C	probably damaging	Het
Kcnj1	G	A	9: 32,396,585	V102I	probably benign	Het
Mnt	C	A	11: 74,842,809		probably benign	Het
Mrpl15	T	C	1: 4,782,660	T112A	probably benign	Het
Ncdn	T	C	4: 126,747,189	D506G	probably benign	Het
Ogdh	C	T	11: 6,313,806	R81*	probably null	Het
Olfr791	T	A	10: 129,526,673	S149T	probably benign	Het
Olfr815	G	C	10: 129,902,409	F100L	probably damaging	Het
Pole	G	T	5: 110,329,583	V1863F	probably damaging	Het
Pramel5	T	C	4: 144,274,007		probably benign	Het
Rabep1	A	G	11: 70,934,537	K636E	probably damaging	Het
Rasgrf2	T	A	13: 91,885,635	Y1151F	probably benign	Het
Rrad	A	G	8: 104,630,636	V93A	probably damaging	Het
Sesn3	A	T	9: 14,310,257	R118*	probably null	Het
Slc27a3	T	C	3: 90,386,290	N596S	probably benign	Het
Supt20	T	C	3: 54,698,597	S35P	probably damaging	Het
Syde2	G	T	3: 146,019,809	R885L	probably benign	Het
Synm	G	A	7: 67,733,658	L1419F	probably damaging	Het
Tcrg-V6	G	T	13: 19,190,644	G40W	possibly damaging	Het
Tekt2	A	G	4: 126,323,443	F221L	probably benign	Het
Ticam1	C	T	17: 56,269,900	E732K	probably benign	Het
Tmem39b	A	G	4: 129,693,148	I90T	possibly damaging	Het
Trib2	A	G	12: 15,815,338	S79P	probably damaging	Het
Usp32	T	C	11: 85,010,143	M1084V	probably benign	Het
Vmn1r181	T	C	7: 23,984,847	F246L	probably damaging	Het
Wnt16	A	G	6: 22,288,511	D2G	probably damaging	Het
Zfp462	A	G	4: 55,080,716	E1357G	probably benign	Het
Zhx3	A	G	2: 160,779,868	M793T	probably benign	Het

Other mutations in Snx19

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00339:Snx19	APN	9	30429084	missense	possibly damaging	0.92
IGL00498:Snx19	APN	9	30428937	missense	possibly damaging	0.92
IGL00718:Snx19	APN	9	30432326	missense	probably damaging	1.00
IGL00902:Snx19	APN	9	30428732	missense	possibly damaging	0.90
IGL01433:Snx19	APN	9	30428771	missense	possibly damaging	0.93
IGL01668:Snx19	APN	9	30427823	missense	probably benign
IGL01732:Snx19	APN	9	30462353	missense	probably damaging	1.00
IGL01767:Snx19	APN	9	30463264	missense	possibly damaging	0.95
IGL02638:Snx19	APN	9	30432364	missense	possibly damaging	0.52
IGL02718:Snx19	APN	9	30432260	missense	possibly damaging	0.72
IGL02719:Snx19	APN	9	30432260	missense	possibly damaging	0.72
IGL02723:Snx19	APN	9	30432260	missense	possibly damaging	0.72
IGL02724:Snx19	APN	9	30432260	missense	possibly damaging	0.72
IGL02725:Snx19	APN	9	30432260	missense	possibly damaging	0.72
IGL02892:Snx19	APN	9	30428364	missense	probably damaging	1.00
IGL03061:Snx19	APN	9	30433632	missense	probably damaging	0.99
IGL03402:Snx19	APN	9	30440134	missense	possibly damaging	0.89
R0125:Snx19	UTSW	9	30440219	missense	probably damaging	1.00
R0133:Snx19	UTSW	9	30428616	missense	possibly damaging	0.94
R0196:Snx19	UTSW	9	30433387	missense	probably damaging	1.00
R0423:Snx19	UTSW	9	30435837	missense	probably damaging	1.00
R0635:Snx19	UTSW	9	30428810	missense	probably damaging	1.00
R0635:Snx19	UTSW	9	30428811	missense	probably damaging	1.00
R1068:Snx19	UTSW	9	30429018	missense	probably damaging	0.99
R1570:Snx19	UTSW	9	30428343	missense	probably damaging	1.00
R1727:Snx19	UTSW	9	30433366	missense	probably damaging	1.00
R1895:Snx19	UTSW	9	30432324	missense	probably damaging	1.00
R1907:Snx19	UTSW	9	30433576	missense	probably damaging	0.99
R1946:Snx19	UTSW	9	30432324	missense	probably damaging	1.00
R1989:Snx19	UTSW	9	30428108	missense	possibly damaging	0.93
R2029:Snx19	UTSW	9	30429000	missense	probably benign	0.01
R2914:Snx19	UTSW	9	30433532	unclassified	probably benign
R3880:Snx19	UTSW	9	30462392	missense	probably damaging	1.00
R4223:Snx19	UTSW	9	30428448	missense	possibly damaging	0.95
R4415:Snx19	UTSW	9	30437483	missense	probably damaging	0.99
R4438:Snx19	UTSW	9	30428599	missense	probably benign	0.01
R4484:Snx19	UTSW	9	30427896	missense	probably benign	0.01
R4585:Snx19	UTSW	9	30440195	missense	probably damaging	1.00
R4765:Snx19	UTSW	9	30440157	missense	probably damaging	1.00
R4771:Snx19	UTSW	9	30433638	missense	probably damaging	1.00
R4922:Snx19	UTSW	9	30437467	missense	probably benign	0.25
R5096:Snx19	UTSW	9	30428786	missense	probably benign	0.40
R5464:Snx19	UTSW	9	30427973	missense	possibly damaging	0.54
R6469:Snx19	UTSW	9	30427743	missense	possibly damaging	0.50
R6886:Snx19	UTSW	9	30428935	missense	probably damaging	1.00
R7131:Snx19	UTSW	9	30427893	missense	probably damaging	1.00
R7268:Snx19	UTSW	9	30440177	missense	probably damaging	1.00
R7772:Snx19	UTSW	9	30428925	missense	probably damaging	0.99
R8087:Snx19	UTSW	9	30464402	missense	probably benign
R8211:Snx19	UTSW	9	30437465	missense	probably benign
R8283:Snx19	UTSW	9	30463226	missense	possibly damaging	0.56
R9000:Snx19	UTSW	9	30464323	missense	unknown
R9383:Snx19	UTSW	9	30435900	missense	probably damaging	1.00
R9436:Snx19	UTSW	9	30463306	missense	possibly damaging	0.55
X0019:Snx19	UTSW	9	30437366	missense	probably damaging	1.00
X0024:Snx19	UTSW	9	30427721	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- GACAGGATTCAAGATGCTCTGTG -3'
(R):5'- AAGGTTCTGGATGACAACCGG -3'

Sequencing Primer
(F):5'- AAGATGCTCTGTGTGCCCTAGAC -3'
(R):5'- ACTGCTCAGGGACTCGAAG -3'

Posted On

2018-11-28