Incidental Mutation 'R6988:Olfr791'
ID 543092
Institutional Source Beutler Lab
Gene Symbol Olfr791
Ensembl Gene ENSMUSG00000047626
Gene Name olfactory receptor 791
Synonyms GA_x6K02T2PULF-11205096-11206034, MOR114-1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock # R6988 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 129521792-129528353 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 129526673 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 149 (S149T)
Ref Sequence ENSEMBL: ENSMUSP00000150497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057477] [ENSMUST00000217228]
AlphaFold Q8VGJ0
Predicted Effect probably benign
Transcript: ENSMUST00000057477
AA Change: S149T

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000052722
Gene: ENSMUSG00000047626
AA Change: S149T

DomainStartEndE-ValueType
Pfam:7tm_4 29 307 7.6e-45 PFAM
Pfam:7TM_GPCR_Srsx 33 303 4.3e-6 PFAM
Pfam:7tm_1 39 288 4.7e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217228
AA Change: S149T

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik T G 4: 137,454,579 L15W probably damaging Het
4930550C14Rik G A 9: 53,411,756 V31I possibly damaging Het
4932415D10Rik T C 10: 82,291,899 D1759G possibly damaging Het
Adgre1 C T 17: 57,408,445 S255F probably benign Het
Aff4 T G 11: 53,398,237 S404R probably damaging Het
Akr1c19 A T 13: 4,233,758 probably benign Het
Ankrd31 T A 13: 96,878,249 I1342K probably damaging Het
Arhgap5 T A 12: 52,518,125 D626E possibly damaging Het
Arhgef1 G A 7: 24,916,923 V332I probably benign Het
AY358078 A G 14: 51,826,187 E430G probably damaging Het
B4gat1 T A 19: 5,040,434 I395N probably benign Het
Bub1b T A 2: 118,636,830 I878N probably damaging Het
Ccdc150 C T 1: 54,355,709 Q745* probably null Het
Ccl19 A T 4: 42,754,885 I87N probably damaging Het
Ces2g G C 8: 104,963,908 G107A probably benign Het
Chpt1 A G 10: 88,488,406 V180A probably damaging Het
Col2a1 T C 15: 98,004,454 T14A unknown Het
Dnah7a T C 1: 53,582,625 I1114V possibly damaging Het
Dnah7c T C 1: 46,666,213 I2462T possibly damaging Het
Dnah8 T C 17: 30,643,275 F208S probably damaging Het
Dnhd1 A G 7: 105,714,210 E3993G probably damaging Het
Erv3 C T 2: 131,855,966 D158N possibly damaging Het
Exoc6 T A 19: 37,609,091 F647I probably damaging Het
Fbrs G A 7: 127,479,508 probably benign Het
Fgfr1op2 T C 6: 146,589,965 F109L probably damaging Het
Fv1 T C 4: 147,869,271 F98S possibly damaging Het
Gm436 A G 4: 144,686,325 F15S probably benign Het
H2-M10.1 T C 17: 36,325,592 K107E probably benign Het
Hspg2 A T 4: 137,528,890 Q1436L probably damaging Het
Ighv1-74 T C 12: 115,802,763 Y79C probably damaging Het
Kcnj1 G A 9: 32,396,585 V102I probably benign Het
Mnt C A 11: 74,842,809 probably benign Het
Mrpl15 T C 1: 4,782,660 T112A probably benign Het
Ncdn T C 4: 126,747,189 D506G probably benign Het
Ogdh C T 11: 6,313,806 R81* probably null Het
Olfr815 G C 10: 129,902,409 F100L probably damaging Het
Pole G T 5: 110,329,583 V1863F probably damaging Het
Pramel5 T C 4: 144,274,007 probably benign Het
Rabep1 A G 11: 70,934,537 K636E probably damaging Het
Rasgrf2 T A 13: 91,885,635 Y1151F probably benign Het
Rrad A G 8: 104,630,636 V93A probably damaging Het
Sesn3 A T 9: 14,310,257 R118* probably null Het
Slc27a3 T C 3: 90,386,290 N596S probably benign Het
Snx19 C A 9: 30,428,935 D456E probably damaging Het
Supt20 T C 3: 54,698,597 S35P probably damaging Het
Syde2 G T 3: 146,019,809 R885L probably benign Het
Synm G A 7: 67,733,658 L1419F probably damaging Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Tekt2 A G 4: 126,323,443 F221L probably benign Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Tmem39b A G 4: 129,693,148 I90T possibly damaging Het
Trib2 A G 12: 15,815,338 S79P probably damaging Het
Usp32 T C 11: 85,010,143 M1084V probably benign Het
Vmn1r181 T C 7: 23,984,847 F246L probably damaging Het
Wnt16 A G 6: 22,288,511 D2G probably damaging Het
Zfp462 A G 4: 55,080,716 E1357G probably benign Het
Zhx3 A G 2: 160,779,868 M793T probably benign Het
Other mutations in Olfr791
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01153:Olfr791 APN 10 129526995 missense probably damaging 0.97
IGL03034:Olfr791 APN 10 129526658 missense probably benign
IGL03281:Olfr791 APN 10 129526403 missense probably benign 0.31
R0555:Olfr791 UTSW 10 129526896 missense possibly damaging 0.90
R1474:Olfr791 UTSW 10 129526955 missense probably benign 0.03
R1638:Olfr791 UTSW 10 129526619 missense probably benign 0.00
R1917:Olfr791 UTSW 10 129527049 missense probably damaging 0.99
R1918:Olfr791 UTSW 10 129527049 missense probably damaging 0.99
R1919:Olfr791 UTSW 10 129527049 missense probably damaging 0.99
R2303:Olfr791 UTSW 10 129527049 missense probably benign 0.10
R3113:Olfr791 UTSW 10 129527143 missense probably benign 0.08
R3929:Olfr791 UTSW 10 129526231 start codon destroyed probably null 1.00
R4704:Olfr791 UTSW 10 129526302 missense possibly damaging 0.90
R4831:Olfr791 UTSW 10 129526580 missense probably damaging 1.00
R5207:Olfr791 UTSW 10 129526904 missense probably benign 0.08
R5313:Olfr791 UTSW 10 129527081 missense probably damaging 1.00
R5644:Olfr791 UTSW 10 129527103 missense probably damaging 1.00
R5661:Olfr791 UTSW 10 129526749 missense probably benign 0.45
R5894:Olfr791 UTSW 10 129526488 missense probably damaging 0.98
R6996:Olfr791 UTSW 10 129526863 missense probably damaging 1.00
R7380:Olfr791 UTSW 10 129526661 missense probably benign
R7539:Olfr791 UTSW 10 129527105 nonsense probably null
R7552:Olfr791 UTSW 10 129526560 missense possibly damaging 0.95
R7635:Olfr791 UTSW 10 129526682 missense probably benign 0.00
R8084:Olfr791 UTSW 10 129526940 missense probably damaging 1.00
R8260:Olfr791 UTSW 10 129527088 missense possibly damaging 0.55
R8755:Olfr791 UTSW 10 129526463 missense possibly damaging 0.60
X0066:Olfr791 UTSW 10 129526745 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAGTTTCCTTTACCACTGTCTG -3'
(R):5'- ATGAGTGCAAAGACAGCCAC -3'

Sequencing Primer
(F):5'- ATACCATCACCTATAATGCTTGTGC -3'
(R):5'- GCCACAAGTATAACCATCTGTTC -3'
Posted On 2018-11-28