Mutagenetix > Incidental Mutations

Incidental Mutation 'R6988:Olfr791'

543092

Institutional Source

Beutler Lab

Gene Symbol

Olfr791

Ensembl Gene

ENSMUSG00000047626

Gene Name

olfactory receptor 791

Synonyms

GA_x6K02T2PULF-11205096-11206034, MOR114-1

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.176) question?

Stock #

R6988 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

129521792-129528353 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 129526673 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 149 (S149T)

Ref Sequence

ENSEMBL: ENSMUSP00000150497 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057477] [ENSMUST00000217228]

Predicted Effect

probably benign
Transcript: ENSMUST00000057477
AA Change: S149T

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000052722
Gene: ENSMUSG00000047626
AA Change: S149T

Domain	Start	End	E-Value	Type
Pfam:7tm_4	29	307	7.6e-45	PFAM
Pfam:7TM_GPCR_Srsx	33	303	4.3e-6	PFAM
Pfam:7tm_1	39	288	4.7e-24	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000217228
AA Change: S149T

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.2%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700013G24Rik	T	G	4: 137,454,579	L15W	probably damaging	Het
4930550C14Rik	G	A	9: 53,411,756	V31I	possibly damaging	Het
4932415D10Rik	T	C	10: 82,291,899	D1759G	possibly damaging	Het
Adgre1	C	T	17: 57,408,445	S255F	probably benign	Het
Aff4	T	G	11: 53,398,237	S404R	probably damaging	Het
Akr1c19	A	T	13: 4,233,758		probably benign	Het
Ankrd31	T	A	13: 96,878,249	I1342K	probably damaging	Het
Arhgap5	T	A	12: 52,518,125	D626E	possibly damaging	Het
Arhgef1	G	A	7: 24,916,923	V332I	probably benign	Het
AY358078	A	G	14: 51,826,187	E430G	probably damaging	Het
B4gat1	T	A	19: 5,040,434	I395N	probably benign	Het
Bub1b	T	A	2: 118,636,830	I878N	probably damaging	Het
Ccdc150	C	T	1: 54,355,709	Q745*	probably null	Het
Ccl19	A	T	4: 42,754,885	I87N	probably damaging	Het
Ces2g	G	C	8: 104,963,908	G107A	probably benign	Het
Chpt1	A	G	10: 88,488,406	V180A	probably damaging	Het
Col2a1	T	C	15: 98,004,454	T14A	unknown	Het
Dnah7a	T	C	1: 53,582,625	I1114V	possibly damaging	Het
Dnah7c	T	C	1: 46,666,213	I2462T	possibly damaging	Het
Dnah8	T	C	17: 30,643,275	F208S	probably damaging	Het
Dnhd1	A	G	7: 105,714,210	E3993G	probably damaging	Het
Erv3	C	T	2: 131,855,966	D158N	possibly damaging	Het
Exoc6	T	A	19: 37,609,091	F647I	probably damaging	Het
Fbrs	G	A	7: 127,479,508		probably benign	Het
Fgfr1op2	T	C	6: 146,589,965	F109L	probably damaging	Het
Fv1	T	C	4: 147,869,271	F98S	possibly damaging	Het
Gm436	A	G	4: 144,686,325	F15S	probably benign	Het
H2-M10.1	T	C	17: 36,325,592	K107E	probably benign	Het
Hspg2	A	T	4: 137,528,890	Q1436L	probably damaging	Het
Ighv1-74	T	C	12: 115,802,763	Y79C	probably damaging	Het
Kcnj1	G	A	9: 32,396,585	V102I	probably benign	Het
Mnt	C	A	11: 74,842,809		probably benign	Het
Mrpl15	T	C	1: 4,782,660	T112A	probably benign	Het
Ncdn	T	C	4: 126,747,189	D506G	probably benign	Het
Ogdh	C	T	11: 6,313,806	R81*	probably null	Het
Olfr815	G	C	10: 129,902,409	F100L	probably damaging	Het
Pole	G	T	5: 110,329,583	V1863F	probably damaging	Het
Pramel5	T	C	4: 144,274,007		probably benign	Het
Rabep1	A	G	11: 70,934,537	K636E	probably damaging	Het
Rasgrf2	T	A	13: 91,885,635	Y1151F	probably benign	Het
Rrad	A	G	8: 104,630,636	V93A	probably damaging	Het
Sesn3	A	T	9: 14,310,257	R118*	probably null	Het
Slc27a3	T	C	3: 90,386,290	N596S	probably benign	Het
Snx19	C	A	9: 30,428,935	D456E	probably damaging	Het
Supt20	T	C	3: 54,698,597	S35P	probably damaging	Het
Syde2	G	T	3: 146,019,809	R885L	probably benign	Het
Synm	G	A	7: 67,733,658	L1419F	probably damaging	Het
Tcrg-V6	G	T	13: 19,190,644	G40W	possibly damaging	Het
Tekt2	A	G	4: 126,323,443	F221L	probably benign	Het
Ticam1	C	T	17: 56,269,900	E732K	probably benign	Het
Tmem39b	A	G	4: 129,693,148	I90T	possibly damaging	Het
Trib2	A	G	12: 15,815,338	S79P	probably damaging	Het
Usp32	T	C	11: 85,010,143	M1084V	probably benign	Het
Vmn1r181	T	C	7: 23,984,847	F246L	probably damaging	Het
Wnt16	A	G	6: 22,288,511	D2G	probably damaging	Het
Zfp462	A	G	4: 55,080,716	E1357G	probably benign	Het
Zhx3	A	G	2: 160,779,868	M793T	probably benign	Het

Other mutations in Olfr791

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01153:Olfr791	APN	10	129526995	missense	probably damaging	0.97
IGL03034:Olfr791	APN	10	129526658	missense	probably benign
IGL03281:Olfr791	APN	10	129526403	missense	probably benign	0.31
R0555:Olfr791	UTSW	10	129526896	missense	possibly damaging	0.90
R1474:Olfr791	UTSW	10	129526955	missense	probably benign	0.03
R1638:Olfr791	UTSW	10	129526619	missense	probably benign	0.00
R1917:Olfr791	UTSW	10	129527049	missense	probably damaging	0.99
R1918:Olfr791	UTSW	10	129527049	missense	probably damaging	0.99
R1919:Olfr791	UTSW	10	129527049	missense	probably damaging	0.99
R2303:Olfr791	UTSW	10	129527049	missense	probably benign	0.10
R3113:Olfr791	UTSW	10	129527143	missense	probably benign	0.08
R3929:Olfr791	UTSW	10	129526231	start codon destroyed	probably null	1.00
R4704:Olfr791	UTSW	10	129526302	missense	possibly damaging	0.90
R4831:Olfr791	UTSW	10	129526580	missense	probably damaging	1.00
R5207:Olfr791	UTSW	10	129526904	missense	probably benign	0.08
R5313:Olfr791	UTSW	10	129527081	missense	probably damaging	1.00
R5644:Olfr791	UTSW	10	129527103	missense	probably damaging	1.00
R5661:Olfr791	UTSW	10	129526749	missense	probably benign	0.45
R5894:Olfr791	UTSW	10	129526488	missense	probably damaging	0.98
R6996:Olfr791	UTSW	10	129526863	missense	probably damaging	1.00
R7380:Olfr791	UTSW	10	129526661	missense	probably benign
R7539:Olfr791	UTSW	10	129527105	nonsense	probably null
R7552:Olfr791	UTSW	10	129526560	missense	possibly damaging	0.95
R7635:Olfr791	UTSW	10	129526682	missense	probably benign	0.00
R8084:Olfr791	UTSW	10	129526940	missense	probably damaging	1.00
R8260:Olfr791	UTSW	10	129527088	missense	possibly damaging	0.55
X0066:Olfr791	UTSW	10	129526745	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGAAGTTTCCTTTACCACTGTCTG -3'
(R):5'- ATGAGTGCAAAGACAGCCAC -3'

Sequencing Primer
(F):5'- ATACCATCACCTATAATGCTTGTGC -3'
(R):5'- GCCACAAGTATAACCATCTGTTC -3'

Posted On

2018-11-28