Incidental Mutation 'R6988:Olfr815'
ID543093
Institutional Source Beutler Lab
Gene Symbol Olfr815
Ensembl Gene ENSMUSG00000061961
Gene Nameolfactory receptor 815
SynonymsGA_x6K02T2PULF-11581263-11580331, MOR113-3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R6988 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location129900570-129905867 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 129902409 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 100 (F100L)
Ref Sequence ENSEMBL: ENSMUSP00000151146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071557] [ENSMUST00000216182]
Predicted Effect probably damaging
Transcript: ENSMUST00000071557
AA Change: F106L

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000071488
Gene: ENSMUSG00000061961
AA Change: F106L

DomainStartEndE-ValueType
Pfam:7tm_4 35 313 4.2e-45 PFAM
Pfam:7tm_1 45 294 1.2e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216182
AA Change: F100L

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik T G 4: 137,454,579 L15W probably damaging Het
4930550C14Rik G A 9: 53,411,756 V31I possibly damaging Het
4932415D10Rik T C 10: 82,291,899 D1759G possibly damaging Het
Adgre1 C T 17: 57,408,445 S255F probably benign Het
Aff4 T G 11: 53,398,237 S404R probably damaging Het
Akr1c19 A T 13: 4,233,758 probably benign Het
Ankrd31 T A 13: 96,878,249 I1342K probably damaging Het
Arhgap5 T A 12: 52,518,125 D626E possibly damaging Het
Arhgef1 G A 7: 24,916,923 V332I probably benign Het
AY358078 A G 14: 51,826,187 E430G probably damaging Het
B4gat1 T A 19: 5,040,434 I395N probably benign Het
Bub1b T A 2: 118,636,830 I878N probably damaging Het
Ccdc150 C T 1: 54,355,709 Q745* probably null Het
Ccl19 A T 4: 42,754,885 I87N probably damaging Het
Ces2g G C 8: 104,963,908 G107A probably benign Het
Chpt1 A G 10: 88,488,406 V180A probably damaging Het
Col2a1 T C 15: 98,004,454 T14A unknown Het
Dnah7a T C 1: 53,582,625 I1114V possibly damaging Het
Dnah7c T C 1: 46,666,213 I2462T possibly damaging Het
Dnah8 T C 17: 30,643,275 F208S probably damaging Het
Dnhd1 A G 7: 105,714,210 E3993G probably damaging Het
Erv3 C T 2: 131,855,966 D158N possibly damaging Het
Exoc6 T A 19: 37,609,091 F647I probably damaging Het
Fbrs G A 7: 127,479,508 probably benign Het
Fgfr1op2 T C 6: 146,589,965 F109L probably damaging Het
Fv1 T C 4: 147,869,271 F98S possibly damaging Het
Gm436 A G 4: 144,686,325 F15S probably benign Het
H2-M10.1 T C 17: 36,325,592 K107E probably benign Het
Hspg2 A T 4: 137,528,890 Q1436L probably damaging Het
Ighv1-74 T C 12: 115,802,763 Y79C probably damaging Het
Kcnj1 G A 9: 32,396,585 V102I probably benign Het
Mnt C A 11: 74,842,809 probably benign Het
Mrpl15 T C 1: 4,782,660 T112A probably benign Het
Ncdn T C 4: 126,747,189 D506G probably benign Het
Ogdh C T 11: 6,313,806 R81* probably null Het
Olfr791 T A 10: 129,526,673 S149T probably benign Het
Pole G T 5: 110,329,583 V1863F probably damaging Het
Pramel5 T C 4: 144,274,007 probably benign Het
Rabep1 A G 11: 70,934,537 K636E probably damaging Het
Rasgrf2 T A 13: 91,885,635 Y1151F probably benign Het
Rrad A G 8: 104,630,636 V93A probably damaging Het
Sesn3 A T 9: 14,310,257 R118* probably null Het
Slc27a3 T C 3: 90,386,290 N596S probably benign Het
Snx19 C A 9: 30,428,935 D456E probably damaging Het
Supt20 T C 3: 54,698,597 S35P probably damaging Het
Syde2 G T 3: 146,019,809 R885L probably benign Het
Synm G A 7: 67,733,658 L1419F probably damaging Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Tekt2 A G 4: 126,323,443 F221L probably benign Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Tmem39b A G 4: 129,693,148 I90T possibly damaging Het
Trib2 A G 12: 15,815,338 S79P probably damaging Het
Usp32 T C 11: 85,010,143 M1084V probably benign Het
Vmn1r181 T C 7: 23,984,847 F246L probably damaging Het
Wnt16 A G 6: 22,288,511 D2G probably damaging Het
Zfp462 A G 4: 55,080,716 E1357G probably benign Het
Zhx3 A G 2: 160,779,868 M793T probably benign Het
Other mutations in Olfr815
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Olfr815 APN 10 129902659 missense possibly damaging 0.94
IGL01901:Olfr815 APN 10 129901853 missense probably benign 0.19
IGL02687:Olfr815 APN 10 129902102 missense probably benign 0.00
IGL02932:Olfr815 APN 10 129902418 nonsense probably null
IGL03327:Olfr815 APN 10 129902582 missense possibly damaging 0.87
R0894:Olfr815 UTSW 10 129901882 missense probably damaging 0.97
R1299:Olfr815 UTSW 10 129902077 missense probably benign 0.32
R1544:Olfr815 UTSW 10 129902424 nonsense probably null
R1939:Olfr815 UTSW 10 129902101 missense probably damaging 0.96
R2379:Olfr815 UTSW 10 129901912 missense probably damaging 0.99
R2435:Olfr815 UTSW 10 129902304 missense possibly damaging 0.52
R2566:Olfr815 UTSW 10 129902095 missense probably damaging 1.00
R2892:Olfr815 UTSW 10 129901940 missense possibly damaging 0.60
R2905:Olfr815 UTSW 10 129902400 missense possibly damaging 0.93
R4552:Olfr815 UTSW 10 129902123 missense probably benign 0.00
R6566:Olfr815 UTSW 10 129902078 missense probably benign 0.00
R7671:Olfr815 UTSW 10 129902353 missense probably damaging 1.00
Z1088:Olfr815 UTSW 10 129902683 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- TGGTCAATGACATTTGAAGCAC -3'
(R):5'- CGGGAATTTAGCTATCATTGCCC -3'

Sequencing Primer
(F):5'- TCAAGGCCAATAATCAGTGGTG -3'
(R):5'- GAATTTAGCTATCATTGCCCTCACTC -3'
Posted On2018-11-28