Incidental Mutation 'R6988:Rabep1'
ID543096
Institutional Source Beutler Lab
Gene Symbol Rabep1
Ensembl Gene ENSMUSG00000020817
Gene Namerabaptin, RAB GTPase binding effector protein 1
Synonymsneurocrescin, RAB5 effector protein, rabaptin-5
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.687) question?
Stock #R6988 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location70844778-70943105 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70934537 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 636 (K636E)
Ref Sequence ENSEMBL: ENSMUSP00000136069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076270] [ENSMUST00000081362] [ENSMUST00000100928] [ENSMUST00000108533] [ENSMUST00000177731] [ENSMUST00000178245]
Predicted Effect probably damaging
Transcript: ENSMUST00000076270
AA Change: K720E

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000075619
Gene: ENSMUSG00000020817
AA Change: K720E

DomainStartEndE-ValueType
Pfam:Rabaptin 89 195 8.8e-47 PFAM
low complexity region 314 327 N/A INTRINSIC
Pfam:Rabaptin 461 596 7.6e-39 PFAM
Pfam:Rab5-bind 612 807 5.7e-51 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000081362
AA Change: K680E

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000080102
Gene: ENSMUSG00000020817
AA Change: K680E

DomainStartEndE-ValueType
Pfam:Rabaptin 89 198 2.4e-45 PFAM
low complexity region 274 287 N/A INTRINSIC
Pfam:Rabaptin 421 556 7.1e-39 PFAM
Pfam:Rab5-bind 572 767 5.2e-51 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000100928
AA Change: K685E

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000098488
Gene: ENSMUSG00000020817
AA Change: K685E

DomainStartEndE-ValueType
Pfam:Rabaptin 89 195 8.3e-47 PFAM
low complexity region 314 327 N/A INTRINSIC
Pfam:Rabaptin 461 561 2.9e-27 PFAM
Pfam:Rab5-bind 577 772 5.3e-51 PFAM
low complexity region 803 817 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108533
AA Change: K720E

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000104173
Gene: ENSMUSG00000020817
AA Change: K720E

DomainStartEndE-ValueType
Pfam:Rabaptin 9 495 2.8e-301 PFAM
Pfam:Rab5-bind 533 841 2e-142 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177731
AA Change: K636E

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000136069
Gene: ENSMUSG00000020817
AA Change: K636E

DomainStartEndE-ValueType
Pfam:Rabaptin 5 111 6.2e-47 PFAM
low complexity region 230 243 N/A INTRINSIC
Pfam:Rabaptin 377 512 5.3e-39 PFAM
Pfam:Rab5-bind 528 723 1.4e-50 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000178245
AA Change: K677E

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000137267
Gene: ENSMUSG00000020817
AA Change: K677E

DomainStartEndE-ValueType
Pfam:Rabaptin 46 152 8.2e-47 PFAM
low complexity region 271 284 N/A INTRINSIC
Pfam:Rabaptin 418 553 7e-39 PFAM
Pfam:Rab5-bind 569 764 5.2e-51 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik T G 4: 137,454,579 L15W probably damaging Het
4930550C14Rik G A 9: 53,411,756 V31I possibly damaging Het
4932415D10Rik T C 10: 82,291,899 D1759G possibly damaging Het
Adgre1 C T 17: 57,408,445 S255F probably benign Het
Aff4 T G 11: 53,398,237 S404R probably damaging Het
Akr1c19 A T 13: 4,233,758 probably benign Het
Ankrd31 T A 13: 96,878,249 I1342K probably damaging Het
Arhgap5 T A 12: 52,518,125 D626E possibly damaging Het
Arhgef1 G A 7: 24,916,923 V332I probably benign Het
AY358078 A G 14: 51,826,187 E430G probably damaging Het
B4gat1 T A 19: 5,040,434 I395N probably benign Het
Bub1b T A 2: 118,636,830 I878N probably damaging Het
Ccdc150 C T 1: 54,355,709 Q745* probably null Het
Ccl19 A T 4: 42,754,885 I87N probably damaging Het
Ces2g G C 8: 104,963,908 G107A probably benign Het
Chpt1 A G 10: 88,488,406 V180A probably damaging Het
Col2a1 T C 15: 98,004,454 T14A unknown Het
Dnah7a T C 1: 53,582,625 I1114V possibly damaging Het
Dnah7c T C 1: 46,666,213 I2462T possibly damaging Het
Dnah8 T C 17: 30,643,275 F208S probably damaging Het
Dnhd1 A G 7: 105,714,210 E3993G probably damaging Het
Erv3 C T 2: 131,855,966 D158N possibly damaging Het
Exoc6 T A 19: 37,609,091 F647I probably damaging Het
Fbrs G A 7: 127,479,508 probably benign Het
Fgfr1op2 T C 6: 146,589,965 F109L probably damaging Het
Fv1 T C 4: 147,869,271 F98S possibly damaging Het
Gm436 A G 4: 144,686,325 F15S probably benign Het
H2-M10.1 T C 17: 36,325,592 K107E probably benign Het
Hspg2 A T 4: 137,528,890 Q1436L probably damaging Het
Ighv1-74 T C 12: 115,802,763 Y79C probably damaging Het
Kcnj1 G A 9: 32,396,585 V102I probably benign Het
Mnt C A 11: 74,842,809 probably benign Het
Mrpl15 T C 1: 4,782,660 T112A probably benign Het
Ncdn T C 4: 126,747,189 D506G probably benign Het
Ogdh C T 11: 6,313,806 R81* probably null Het
Olfr791 T A 10: 129,526,673 S149T probably benign Het
Olfr815 G C 10: 129,902,409 F100L probably damaging Het
Pole G T 5: 110,329,583 V1863F probably damaging Het
Pramel5 T C 4: 144,274,007 probably benign Het
Rasgrf2 T A 13: 91,885,635 Y1151F probably benign Het
Rrad A G 8: 104,630,636 V93A probably damaging Het
Sesn3 A T 9: 14,310,257 R118* probably null Het
Slc27a3 T C 3: 90,386,290 N596S probably benign Het
Snx19 C A 9: 30,428,935 D456E probably damaging Het
Supt20 T C 3: 54,698,597 S35P probably damaging Het
Syde2 G T 3: 146,019,809 R885L probably benign Het
Synm G A 7: 67,733,658 L1419F probably damaging Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Tekt2 A G 4: 126,323,443 F221L probably benign Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Tmem39b A G 4: 129,693,148 I90T possibly damaging Het
Trib2 A G 12: 15,815,338 S79P probably damaging Het
Usp32 T C 11: 85,010,143 M1084V probably benign Het
Vmn1r181 T C 7: 23,984,847 F246L probably damaging Het
Wnt16 A G 6: 22,288,511 D2G probably damaging Het
Zfp462 A G 4: 55,080,716 E1357G probably benign Het
Zhx3 A G 2: 160,779,868 M793T probably benign Het
Other mutations in Rabep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01370:Rabep1 APN 11 70925781 missense probably benign 0.00
IGL02022:Rabep1 APN 11 70934559 missense probably damaging 1.00
IGL02215:Rabep1 APN 11 70923197 nonsense probably null
IGL02428:Rabep1 APN 11 70917480 missense probably benign 0.00
IGL02566:Rabep1 APN 11 70917714 missense probably damaging 1.00
IGL02868:Rabep1 APN 11 70874746 missense probably benign 0.00
F5770:Rabep1 UTSW 11 70937516 splice site probably benign
P0042:Rabep1 UTSW 11 70884975 splice site probably benign
PIT4495001:Rabep1 UTSW 11 70917579 missense probably damaging 1.00
R0328:Rabep1 UTSW 11 70919207 missense probably damaging 1.00
R0458:Rabep1 UTSW 11 70886998 splice site probably null
R0477:Rabep1 UTSW 11 70920907 missense probably damaging 1.00
R0727:Rabep1 UTSW 11 70900492 nonsense probably null
R1732:Rabep1 UTSW 11 70904641 missense probably damaging 1.00
R1837:Rabep1 UTSW 11 70904658 missense probably damaging 1.00
R2203:Rabep1 UTSW 11 70934574 missense probably damaging 1.00
R4003:Rabep1 UTSW 11 70917367 missense probably benign 0.12
R4229:Rabep1 UTSW 11 70908434 missense probably benign
R4573:Rabep1 UTSW 11 70917751 missense probably damaging 1.00
R4748:Rabep1 UTSW 11 70908468 missense probably benign 0.18
R5130:Rabep1 UTSW 11 70904731 missense probably damaging 1.00
R5182:Rabep1 UTSW 11 70904628 nonsense probably null
R5379:Rabep1 UTSW 11 70908421 missense probably damaging 1.00
R5525:Rabep1 UTSW 11 70923146 missense probably damaging 1.00
R5617:Rabep1 UTSW 11 70917529 missense probably damaging 1.00
R6283:Rabep1 UTSW 11 70917679 missense probably damaging 1.00
R6302:Rabep1 UTSW 11 70935121 missense probably damaging 1.00
R6730:Rabep1 UTSW 11 70940386 missense possibly damaging 0.88
R7235:Rabep1 UTSW 11 70940464 missense probably benign 0.43
R7241:Rabep1 UTSW 11 70939989 missense probably damaging 1.00
R7453:Rabep1 UTSW 11 70917660 missense probably damaging 1.00
R7955:Rabep1 UTSW 11 70917441 missense probably damaging 0.96
R8175:Rabep1 UTSW 11 70884929 missense probably damaging 1.00
R8314:Rabep1 UTSW 11 70893660 missense possibly damaging 0.93
R8461:Rabep1 UTSW 11 70884855 missense possibly damaging 0.56
R8481:Rabep1 UTSW 11 70887127 missense probably damaging 1.00
R8530:Rabep1 UTSW 11 70919242 missense probably damaging 1.00
R8531:Rabep1 UTSW 11 70908506 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCCACAAATCCAGTAACCTTGTG -3'
(R):5'- GGCTTTCACAGTGACTGCAC -3'

Sequencing Primer
(F):5'- AACCTTGTGTTTACGGAATCCAGG -3'
(R):5'- ACCGAGGACAGCTGTTCTTTTATAC -3'
Posted On2018-11-28