Incidental Mutation 'R6988:Mnt'
ID543097
Institutional Source Beutler Lab
Gene Symbol Mnt
Ensembl Gene ENSMUSG00000000282
Gene Namemax binding protein
SynonymsbHLHd3, Rox
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.939) question?
Stock #R6988 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location74830920-74845725 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to A at 74842809 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118435 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000291] [ENSMUST00000132150]
Predicted Effect unknown
Transcript: ENSMUST00000000291
AA Change: P422Q
SMART Domains Protein: ENSMUSP00000000291
Gene: ENSMUSG00000000282
AA Change: P422Q

DomainStartEndE-ValueType
coiled coil region 3 53 N/A INTRINSIC
low complexity region 64 88 N/A INTRINSIC
low complexity region 100 125 N/A INTRINSIC
low complexity region 182 205 N/A INTRINSIC
HLH 228 279 2.99e-13 SMART
low complexity region 368 431 N/A INTRINSIC
low complexity region 469 481 N/A INTRINSIC
low complexity region 515 527 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132150
SMART Domains Protein: ENSMUSP00000118435
Gene: ENSMUSG00000000282

DomainStartEndE-ValueType
HLH 1 47 2.92e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Myc/Max/Mad network comprises a group of transcription factors that co-interact to regulate gene-specific transcriptional activation or repression. This gene encodes a protein member of the Myc/Max/Mad network. This protein has a basic-Helix-Loop-Helix-zipper domain (bHLHzip) with which it binds the canonical DNA sequence CANNTG, known as the E box, following heterodimerization with Max proteins. This protein is likely a transcriptional repressor and an antagonist of Myc-dependent transcriptional activation and cell growth. This protein represses transcription by binding to DNA binding proteins at its N-terminal Sin3-interaction domain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most homozygotes for a targeted null mutation are runted at birth and die within a few days, while mutant fibroblasts show abnormal cell cycling. Those homozygotes that survive are fertile and attain normal Heterozygotes for a conditional mammary epithelial specific knockout develop adenocarcinomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik T G 4: 137,454,579 L15W probably damaging Het
4930550C14Rik G A 9: 53,411,756 V31I possibly damaging Het
4932415D10Rik T C 10: 82,291,899 D1759G possibly damaging Het
Adgre1 C T 17: 57,408,445 S255F probably benign Het
Aff4 T G 11: 53,398,237 S404R probably damaging Het
Akr1c19 A T 13: 4,233,758 probably benign Het
Ankrd31 T A 13: 96,878,249 I1342K probably damaging Het
Arhgap5 T A 12: 52,518,125 D626E possibly damaging Het
Arhgef1 G A 7: 24,916,923 V332I probably benign Het
AY358078 A G 14: 51,826,187 E430G probably damaging Het
B4gat1 T A 19: 5,040,434 I395N probably benign Het
Bub1b T A 2: 118,636,830 I878N probably damaging Het
Ccdc150 C T 1: 54,355,709 Q745* probably null Het
Ccl19 A T 4: 42,754,885 I87N probably damaging Het
Ces2g G C 8: 104,963,908 G107A probably benign Het
Chpt1 A G 10: 88,488,406 V180A probably damaging Het
Col2a1 T C 15: 98,004,454 T14A unknown Het
Dnah7a T C 1: 53,582,625 I1114V possibly damaging Het
Dnah7c T C 1: 46,666,213 I2462T possibly damaging Het
Dnah8 T C 17: 30,643,275 F208S probably damaging Het
Dnhd1 A G 7: 105,714,210 E3993G probably damaging Het
Erv3 C T 2: 131,855,966 D158N possibly damaging Het
Exoc6 T A 19: 37,609,091 F647I probably damaging Het
Fbrs G A 7: 127,479,508 probably benign Het
Fgfr1op2 T C 6: 146,589,965 F109L probably damaging Het
Fv1 T C 4: 147,869,271 F98S possibly damaging Het
Gm436 A G 4: 144,686,325 F15S probably benign Het
H2-M10.1 T C 17: 36,325,592 K107E probably benign Het
Hspg2 A T 4: 137,528,890 Q1436L probably damaging Het
Ighv1-74 T C 12: 115,802,763 Y79C probably damaging Het
Kcnj1 G A 9: 32,396,585 V102I probably benign Het
Mrpl15 T C 1: 4,782,660 T112A probably benign Het
Ncdn T C 4: 126,747,189 D506G probably benign Het
Ogdh C T 11: 6,313,806 R81* probably null Het
Olfr791 T A 10: 129,526,673 S149T probably benign Het
Olfr815 G C 10: 129,902,409 F100L probably damaging Het
Pole G T 5: 110,329,583 V1863F probably damaging Het
Pramel5 T C 4: 144,274,007 probably benign Het
Rabep1 A G 11: 70,934,537 K636E probably damaging Het
Rasgrf2 T A 13: 91,885,635 Y1151F probably benign Het
Rrad A G 8: 104,630,636 V93A probably damaging Het
Sesn3 A T 9: 14,310,257 R118* probably null Het
Slc27a3 T C 3: 90,386,290 N596S probably benign Het
Snx19 C A 9: 30,428,935 D456E probably damaging Het
Supt20 T C 3: 54,698,597 S35P probably damaging Het
Syde2 G T 3: 146,019,809 R885L probably benign Het
Synm G A 7: 67,733,658 L1419F probably damaging Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Tekt2 A G 4: 126,323,443 F221L probably benign Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Tmem39b A G 4: 129,693,148 I90T possibly damaging Het
Trib2 A G 12: 15,815,338 S79P probably damaging Het
Usp32 T C 11: 85,010,143 M1084V probably benign Het
Vmn1r181 T C 7: 23,984,847 F246L probably damaging Het
Wnt16 A G 6: 22,288,511 D2G probably damaging Het
Zfp462 A G 4: 55,080,716 E1357G probably benign Het
Zhx3 A G 2: 160,779,868 M793T probably benign Het
Other mutations in Mnt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:Mnt APN 11 74842185 missense probably damaging 1.00
R0599:Mnt UTSW 11 74842296 missense probably benign 0.09
R2100:Mnt UTSW 11 74831351 missense probably damaging 1.00
R3076:Mnt UTSW 11 74843110 intron probably benign
R3077:Mnt UTSW 11 74843110 intron probably benign
R3078:Mnt UTSW 11 74843110 intron probably benign
R3605:Mnt UTSW 11 74836920 missense possibly damaging 0.89
R4601:Mnt UTSW 11 74836459 missense possibly damaging 0.76
R5766:Mnt UTSW 11 74843078 intron probably benign
R6340:Mnt UTSW 11 74836416 missense probably damaging 1.00
R7460:Mnt UTSW 11 74843283 missense unknown
R7970:Mnt UTSW 11 74842210 missense probably damaging 1.00
R8145:Mnt UTSW 11 74842973 missense unknown
R8544:Mnt UTSW 11 74831392 missense probably damaging 0.97
Z1176:Mnt UTSW 11 74836675 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAGCTGAACCATCGTCCCC -3'
(R):5'- ATTTACTTGCTGGTGCGACAG -3'

Sequencing Primer
(F):5'- ATCGTCCCCAGCCGGAG -3'
(R):5'- CAAGGTGGGCCACATGGTTG -3'
Posted On2018-11-28