Mutagenetix > Incidental Mutations

Incidental Mutation 'R6988:Usp32'

543098

Institutional Source

Beutler Lab

Gene Symbol

Usp32

Ensembl Gene

ENSMUSG00000000804

Gene Name

ubiquitin specific peptidase 32

Synonyms

6430526O11Rik, 2900074J03Rik

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6988 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

84984442-85140161 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 85010143 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 1084 (M1084V)

Ref Sequence

ENSEMBL: ENSMUSP00000103710 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000108075]

Predicted Effect

probably benign
Transcript: ENSMUST00000000821

SMART Domains

Protein: ENSMUSP00000000821
Gene: ENSMUSG00000000804

Domain	Start	End	E-Value	Type
Pfam:UCH	32	260	4.1e-51	PFAM
Pfam:UCH_1	33	228	1.7e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000108075
AA Change: M1084V

PolyPhen 2 Score 0.348 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000103710
Gene: ENSMUSG00000000804
AA Change: M1084V

Domain	Start	End	E-Value	Type
EFh	232	260	4.66e0	SMART
EFh	268	296	5.8e-1	SMART
Blast:EFh	318	346	5e-7	BLAST
DUSP	389	588	2.32e-16	SMART
Pfam:Ubiquitin_3	628	711	2.4e-9	PFAM
Pfam:UCH	733	1564	2.4e-83	PFAM
Pfam:UCH_1	1202	1547	2.9e-12	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700013G24Rik	T	G	4: 137,454,579	L15W	probably damaging	Het
4930550C14Rik	G	A	9: 53,411,756	V31I	possibly damaging	Het
4932415D10Rik	T	C	10: 82,291,899	D1759G	possibly damaging	Het
Adgre1	C	T	17: 57,408,445	S255F	probably benign	Het
Aff4	T	G	11: 53,398,237	S404R	probably damaging	Het
Akr1c19	A	T	13: 4,233,758		probably benign	Het
Ankrd31	T	A	13: 96,878,249	I1342K	probably damaging	Het
Arhgap5	T	A	12: 52,518,125	D626E	possibly damaging	Het
Arhgef1	G	A	7: 24,916,923	V332I	probably benign	Het
AY358078	A	G	14: 51,826,187	E430G	probably damaging	Het
B4gat1	T	A	19: 5,040,434	I395N	probably benign	Het
Bub1b	T	A	2: 118,636,830	I878N	probably damaging	Het
Ccdc150	C	T	1: 54,355,709	Q745*	probably null	Het
Ccl19	A	T	4: 42,754,885	I87N	probably damaging	Het
Ces2g	G	C	8: 104,963,908	G107A	probably benign	Het
Chpt1	A	G	10: 88,488,406	V180A	probably damaging	Het
Col2a1	T	C	15: 98,004,454	T14A	unknown	Het
Dnah7a	T	C	1: 53,582,625	I1114V	possibly damaging	Het
Dnah7c	T	C	1: 46,666,213	I2462T	possibly damaging	Het
Dnah8	T	C	17: 30,643,275	F208S	probably damaging	Het
Dnhd1	A	G	7: 105,714,210	E3993G	probably damaging	Het
Erv3	C	T	2: 131,855,966	D158N	possibly damaging	Het
Exoc6	T	A	19: 37,609,091	F647I	probably damaging	Het
Fbrs	G	A	7: 127,479,508		probably benign	Het
Fgfr1op2	T	C	6: 146,589,965	F109L	probably damaging	Het
Fv1	T	C	4: 147,869,271	F98S	possibly damaging	Het
Gm436	A	G	4: 144,686,325	F15S	probably benign	Het
H2-M10.1	T	C	17: 36,325,592	K107E	probably benign	Het
Hspg2	A	T	4: 137,528,890	Q1436L	probably damaging	Het
Ighv1-74	T	C	12: 115,802,763	Y79C	probably damaging	Het
Kcnj1	G	A	9: 32,396,585	V102I	probably benign	Het
Mnt	C	A	11: 74,842,809		probably benign	Het
Mrpl15	T	C	1: 4,782,660	T112A	probably benign	Het
Ncdn	T	C	4: 126,747,189	D506G	probably benign	Het
Ogdh	C	T	11: 6,313,806	R81*	probably null	Het
Olfr791	T	A	10: 129,526,673	S149T	probably benign	Het
Olfr815	G	C	10: 129,902,409	F100L	probably damaging	Het
Pole	G	T	5: 110,329,583	V1863F	probably damaging	Het
Pramel5	T	C	4: 144,274,007		probably benign	Het
Rabep1	A	G	11: 70,934,537	K636E	probably damaging	Het
Rasgrf2	T	A	13: 91,885,635	Y1151F	probably benign	Het
Rrad	A	G	8: 104,630,636	V93A	probably damaging	Het
Sesn3	A	T	9: 14,310,257	R118*	probably null	Het
Slc27a3	T	C	3: 90,386,290	N596S	probably benign	Het
Snx19	C	A	9: 30,428,935	D456E	probably damaging	Het
Supt20	T	C	3: 54,698,597	S35P	probably damaging	Het
Syde2	G	T	3: 146,019,809	R885L	probably benign	Het
Synm	G	A	7: 67,733,658	L1419F	probably damaging	Het
Tcrg-V6	G	T	13: 19,190,644	G40W	possibly damaging	Het
Tekt2	A	G	4: 126,323,443	F221L	probably benign	Het
Ticam1	C	T	17: 56,269,900	E732K	probably benign	Het
Tmem39b	A	G	4: 129,693,148	I90T	possibly damaging	Het
Trib2	A	G	12: 15,815,338	S79P	probably damaging	Het
Vmn1r181	T	C	7: 23,984,847	F246L	probably damaging	Het
Wnt16	A	G	6: 22,288,511	D2G	probably damaging	Het
Zfp462	A	G	4: 55,080,716	E1357G	probably benign	Het
Zhx3	A	G	2: 160,779,868	M793T	probably benign	Het

Other mutations in Usp32

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00529:Usp32	APN	11	84994426	missense	probably damaging	1.00
IGL00701:Usp32	APN	11	85059125	splice site	probably null
IGL00848:Usp32	APN	11	85051181	splice site	probably benign
IGL00934:Usp32	APN	11	85007076	missense	probably damaging	1.00
IGL01019:Usp32	APN	11	85039265	missense	probably damaging	0.97
IGL01302:Usp32	APN	11	84988482	missense	probably benign	0.05
IGL01444:Usp32	APN	11	85059164	missense	probably damaging	0.97
IGL01575:Usp32	APN	11	85022802	missense	probably damaging	1.00
IGL01981:Usp32	APN	11	85036524	missense	probably benign	0.02
IGL02118:Usp32	APN	11	85032177	nonsense	probably null
IGL02159:Usp32	APN	11	85005802	splice site	probably null
IGL02227:Usp32	APN	11	84986481	missense	probably damaging	1.00
IGL02363:Usp32	APN	11	85044787	missense	probably benign	0.01
IGL02524:Usp32	APN	11	85010011	nonsense	probably null
IGL02613:Usp32	APN	11	85040070	missense	probably damaging	0.99
IGL02720:Usp32	APN	11	85006991	critical splice donor site	probably null
IGL02738:Usp32	APN	11	85083806	missense	probably damaging	1.00
IGL02929:Usp32	APN	11	84988372	missense	probably benign	0.01
IGL03303:Usp32	APN	11	85022832	missense	probably damaging	1.00
BB010:Usp32	UTSW	11	85007059	missense	probably damaging	1.00
BB020:Usp32	UTSW	11	85007059	missense	probably damaging	1.00
PIT4812001:Usp32	UTSW	11	85010074	missense	probably damaging	1.00
R0026:Usp32	UTSW	11	85032074	missense	possibly damaging	0.48
R0295:Usp32	UTSW	11	85053692	missense	probably damaging	0.98
R1320:Usp32	UTSW	11	85017793	missense	probably damaging	0.98
R1712:Usp32	UTSW	11	85042580	missense	probably benign	0.12
R1922:Usp32	UTSW	11	85007004	nonsense	probably null
R1973:Usp32	UTSW	11	85103931	missense	probably benign	0.09
R2010:Usp32	UTSW	11	85040004	missense	probably damaging	0.98
R2082:Usp32	UTSW	11	85030512	missense	probably damaging	0.99
R2355:Usp32	UTSW	11	85005909	missense	probably benign	0.34
R3147:Usp32	UTSW	11	85029087	missense	probably damaging	1.00
R3160:Usp32	UTSW	11	85025536	missense	probably damaging	0.97
R3162:Usp32	UTSW	11	85025536	missense	probably damaging	0.97
R3716:Usp32	UTSW	11	85042563	missense	probably damaging	1.00
R3816:Usp32	UTSW	11	84994384	critical splice donor site	probably null
R3870:Usp32	UTSW	11	85007055	nonsense	probably null
R3871:Usp32	UTSW	11	85081156	missense	probably null	0.81
R4041:Usp32	UTSW	11	85017739	missense	probably benign	0.40
R4079:Usp32	UTSW	11	85039229	missense	probably damaging	0.98
R4332:Usp32	UTSW	11	85103978	missense	possibly damaging	0.79
R4396:Usp32	UTSW	11	85053975	missense	probably benign
R4580:Usp32	UTSW	11	85059127	critical splice donor site	probably null
R4620:Usp32	UTSW	11	85059127	critical splice donor site	probably null
R4744:Usp32	UTSW	11	84994393	missense	probably damaging	1.00
R4909:Usp32	UTSW	11	85055772	nonsense	probably null
R5056:Usp32	UTSW	11	85026795	missense	probably benign	0.07
R5111:Usp32	UTSW	11	85077331	missense	possibly damaging	0.95
R5213:Usp32	UTSW	11	85022259	missense	probably damaging	1.00
R5308:Usp32	UTSW	11	85017718	missense	probably benign	0.12
R5381:Usp32	UTSW	11	85059127	critical splice donor site	probably benign
R5538:Usp32	UTSW	11	85017786	missense	possibly damaging	0.65
R5659:Usp32	UTSW	11	85077414	missense	possibly damaging	0.94
R6006:Usp32	UTSW	11	84992451	critical splice donor site	probably null
R6011:Usp32	UTSW	11	85032097	missense	possibly damaging	0.70
R6029:Usp32	UTSW	11	85025582	missense	probably damaging	0.99
R6074:Usp32	UTSW	11	84994573	missense	probably benign	0.00
R6331:Usp32	UTSW	11	84986576	missense	possibly damaging	0.92
R6353:Usp32	UTSW	11	85022281	missense	probably benign
R6714:Usp32	UTSW	11	85026870	missense	probably damaging	0.99
R6778:Usp32	UTSW	11	85025686	missense	probably benign	0.00
R6992:Usp32	UTSW	11	85032088	missense	probably damaging	0.99
R7182:Usp32	UTSW	11	85040170	missense	probably benign	0.34
R7186:Usp32	UTSW	11	85051234	missense	probably benign	0.45
R7198:Usp32	UTSW	11	85022855	frame shift	probably null
R7201:Usp32	UTSW	11	85022855	frame shift	probably null
R7469:Usp32	UTSW	11	84988553	missense	possibly damaging	0.94
R7502:Usp32	UTSW	11	85022898	missense	possibly damaging	0.48
R7513:Usp32	UTSW	11	85027112	nonsense	probably null
R7629:Usp32	UTSW	11	85019855	frame shift	probably null
R7703:Usp32	UTSW	11	85077327	missense	probably damaging	0.99
R7741:Usp32	UTSW	11	84987281	missense	probably damaging	0.99
R7765:Usp32	UTSW	11	84994408	missense	probably damaging	1.00
R7933:Usp32	UTSW	11	85007059	missense	probably damaging	1.00
R7973:Usp32	UTSW	11	85022808	missense	probably damaging	0.99
R7989:Usp32	UTSW	11	85034300	missense
R7998:Usp32	UTSW	11	84994426	missense	probably damaging	1.00
R8292:Usp32	UTSW	11	85077401	missense	probably damaging	0.99
R8305:Usp32	UTSW	11	85032185	missense	possibly damaging	0.83
R8548:Usp32	UTSW	11	85017827	missense	possibly damaging	0.52
X0028:Usp32	UTSW	11	84992606	missense	probably benign	0.05
Z1177:Usp32	UTSW	11	84988612	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AACCTACCAATCCTGTGCATG -3'
(R):5'- AAACCTTTCTGTGGGTCTCC -3'

Sequencing Primer
(F):5'- GCATGGTTGCTAGCTTCTTGAG -3'
(R):5'- TGGGTCTCCACTTTAAATGGTAG -3'

Posted On

2018-11-28