Mutagenetix > Incidental Mutations

Incidental Mutation 'R6988:Arhgap5'

543100

Institutional Source

Beutler Lab

Gene Symbol

Arhgap5

Ensembl Gene

ENSMUSG00000035133

Gene Name

Rho GTPase activating protein 5

Synonyms

p190B, p190-B

Accession Numbers

Genbank: NM_009706; MGI: 1332637

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6988 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

52503972-52571975 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 52518125 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 626 (D626E)

Ref Sequence

ENSEMBL: ENSMUSP00000151809 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110725] [ENSMUST00000217820] [ENSMUST00000219443]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110725
AA Change: D626E

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000106353
Gene: ENSMUSG00000035133
AA Change: D626E

Domain	Start	End	E-Value	Type
Pfam:Ras	142	248	5.3e-7	PFAM
FF	269	325	6.03e-12	SMART
FF	367	420	4.61e-8	SMART
FF	427	482	2.22e-10	SMART
FF	483	537	3.89e-6	SMART
low complexity region	1035	1053	N/A	INTRINSIC
low complexity region	1224	1247	N/A	INTRINSIC
RhoGAP	1273	1447	1.03e-73	SMART
low complexity region	1479	1496	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000217820

Predicted Effect

possibly damaging
Transcript: ENSMUST00000219443
AA Change: D626E

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.2%

Validation Efficiency

MGI Phenotype

Strain: 2179998
Lethality: D1-D2
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPase activating protein 5 negatively regulates RHO GTPases, a family which may mediate cytoskeleton changes by stimulating the hydrolysis of bound GTP. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes die at birth, are 30% smaller, do not inflate their lungs, and show a small thymus, abnormal adipocyte differentiation and brain defects in the corpus callosum, anterior commissure and lateral ventricles. Mutant MEFs show impaired adipogenesis but undergo myogenesis in response to IGF-1. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Gene trapped(3)

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700013G24Rik	T	G	4: 137,454,579	L15W	probably damaging	Het
4930550C14Rik	G	A	9: 53,411,756	V31I	possibly damaging	Het
4932415D10Rik	T	C	10: 82,291,899	D1759G	possibly damaging	Het
Adgre1	C	T	17: 57,408,445	S255F	probably benign	Het
Aff4	T	G	11: 53,398,237	S404R	probably damaging	Het
Akr1c19	A	T	13: 4,233,758		probably benign	Het
Ankrd31	T	A	13: 96,878,249	I1342K	probably damaging	Het
Arhgef1	G	A	7: 24,916,923	V332I	probably benign	Het
AY358078	A	G	14: 51,826,187	E430G	probably damaging	Het
B4gat1	T	A	19: 5,040,434	I395N	probably benign	Het
Bub1b	T	A	2: 118,636,830	I878N	probably damaging	Het
Ccdc150	C	T	1: 54,355,709	Q745*	probably null	Het
Ccl19	A	T	4: 42,754,885	I87N	probably damaging	Het
Ces2g	G	C	8: 104,963,908	G107A	probably benign	Het
Chpt1	A	G	10: 88,488,406	V180A	probably damaging	Het
Col2a1	T	C	15: 98,004,454	T14A	unknown	Het
Dnah7a	T	C	1: 53,582,625	I1114V	possibly damaging	Het
Dnah7c	T	C	1: 46,666,213	I2462T	possibly damaging	Het
Dnah8	T	C	17: 30,643,275	F208S	probably damaging	Het
Dnhd1	A	G	7: 105,714,210	E3993G	probably damaging	Het
Erv3	C	T	2: 131,855,966	D158N	possibly damaging	Het
Exoc6	T	A	19: 37,609,091	F647I	probably damaging	Het
Fbrs	G	A	7: 127,479,508		probably benign	Het
Fgfr1op2	T	C	6: 146,589,965	F109L	probably damaging	Het
Fv1	T	C	4: 147,869,271	F98S	possibly damaging	Het
Gm436	A	G	4: 144,686,325	F15S	probably benign	Het
H2-M10.1	T	C	17: 36,325,592	K107E	probably benign	Het
Hspg2	A	T	4: 137,528,890	Q1436L	probably damaging	Het
Ighv1-74	T	C	12: 115,802,763	Y79C	probably damaging	Het
Kcnj1	G	A	9: 32,396,585	V102I	probably benign	Het
Mnt	C	A	11: 74,842,809		probably benign	Het
Mrpl15	T	C	1: 4,782,660	T112A	probably benign	Het
Ncdn	T	C	4: 126,747,189	D506G	probably benign	Het
Ogdh	C	T	11: 6,313,806	R81*	probably null	Het
Olfr791	T	A	10: 129,526,673	S149T	probably benign	Het
Olfr815	G	C	10: 129,902,409	F100L	probably damaging	Het
Pole	G	T	5: 110,329,583	V1863F	probably damaging	Het
Pramel5	T	C	4: 144,274,007		probably benign	Het
Rabep1	A	G	11: 70,934,537	K636E	probably damaging	Het
Rasgrf2	T	A	13: 91,885,635	Y1151F	probably benign	Het
Rrad	A	G	8: 104,630,636	V93A	probably damaging	Het
Sesn3	A	T	9: 14,310,257	R118*	probably null	Het
Slc27a3	T	C	3: 90,386,290	N596S	probably benign	Het
Snx19	C	A	9: 30,428,935	D456E	probably damaging	Het
Supt20	T	C	3: 54,698,597	S35P	probably damaging	Het
Syde2	G	T	3: 146,019,809	R885L	probably benign	Het
Synm	G	A	7: 67,733,658	L1419F	probably damaging	Het
Tcrg-V6	G	T	13: 19,190,644	G40W	possibly damaging	Het
Tekt2	A	G	4: 126,323,443	F221L	probably benign	Het
Ticam1	C	T	17: 56,269,900	E732K	probably benign	Het
Tmem39b	A	G	4: 129,693,148	I90T	possibly damaging	Het
Trib2	A	G	12: 15,815,338	S79P	probably damaging	Het
Usp32	T	C	11: 85,010,143	M1084V	probably benign	Het
Vmn1r181	T	C	7: 23,984,847	F246L	probably damaging	Het
Wnt16	A	G	6: 22,288,511	D2G	probably damaging	Het
Zfp462	A	G	4: 55,080,716	E1357G	probably benign	Het
Zhx3	A	G	2: 160,779,868	M793T	probably benign	Het

Other mutations in Arhgap5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00679:Arhgap5	APN	12	52517281	missense	probably damaging	0.98
IGL00823:Arhgap5	APN	12	52518742	missense	possibly damaging	0.84
IGL01161:Arhgap5	APN	12	52516860	missense	probably damaging	1.00
IGL01360:Arhgap5	APN	12	52518240	missense	probably damaging	1.00
IGL01910:Arhgap5	APN	12	52516861	missense	probably benign	0.33
IGL02417:Arhgap5	APN	12	52518353	missense	probably damaging	0.99
IGL02448:Arhgap5	APN	12	52562340	missense	probably damaging	0.97
IGL02813:Arhgap5	APN	12	52516965	missense	probably benign	0.20
IGL03398:Arhgap5	APN	12	52517311	missense	probably damaging	0.99
Decline	UTSW	12	52516582	nonsense	probably null
Pass	UTSW	12	52516507	missense	possibly damaging	0.82
3-1:Arhgap5	UTSW	12	52518882	missense	possibly damaging	0.54
R0039:Arhgap5	UTSW	12	52518735	nonsense	probably null
R0088:Arhgap5	UTSW	12	52516548	missense	probably damaging	1.00
R0104:Arhgap5	UTSW	12	52516717	missense	probably damaging	1.00
R0111:Arhgap5	UTSW	12	52559960	splice site	probably benign
R0356:Arhgap5	UTSW	12	52516308	missense	probably damaging	1.00
R0616:Arhgap5	UTSW	12	52517065	missense	possibly damaging	0.79
R0707:Arhgap5	UTSW	12	52518168	missense	probably damaging	1.00
R0718:Arhgap5	UTSW	12	52516507	missense	possibly damaging	0.82
R0849:Arhgap5	UTSW	12	52519623	missense	probably benign	0.01
R0975:Arhgap5	UTSW	12	52517144	missense	possibly damaging	0.61
R1326:Arhgap5	UTSW	12	52518370	missense	possibly damaging	0.80
R1421:Arhgap5	UTSW	12	52516848	missense	probably damaging	1.00
R1422:Arhgap5	UTSW	12	52519514	missense	probably damaging	1.00
R1625:Arhgap5	UTSW	12	52517376	missense	probably benign
R1711:Arhgap5	UTSW	12	52519345	missense	probably damaging	1.00
R1970:Arhgap5	UTSW	12	52542593	missense	probably damaging	1.00
R2004:Arhgap5	UTSW	12	52518034	missense	probably benign	0.05
R2356:Arhgap5	UTSW	12	52519147	missense	probably benign	0.00
R3792:Arhgap5	UTSW	12	52519888	missense	probably benign	0.21
R3808:Arhgap5	UTSW	12	52567187	missense	possibly damaging	0.72
R4458:Arhgap5	UTSW	12	52517957	missense	probably benign
R4703:Arhgap5	UTSW	12	52517583	missense	probably damaging	0.99
R4736:Arhgap5	UTSW	12	52519077	missense	probably benign	0.00
R4737:Arhgap5	UTSW	12	52519077	missense	probably benign	0.00
R4740:Arhgap5	UTSW	12	52519077	missense	probably benign	0.00
R4768:Arhgap5	UTSW	12	52557492	missense	probably damaging	1.00
R4806:Arhgap5	UTSW	12	52518703	missense	probably damaging	0.99
R4817:Arhgap5	UTSW	12	52519209	missense	possibly damaging	0.71
R5586:Arhgap5	UTSW	12	52519912	missense	possibly damaging	0.95
R5681:Arhgap5	UTSW	12	52519779	missense	probably benign	0.21
R5683:Arhgap5	UTSW	12	52519586	missense	probably benign
R5911:Arhgap5	UTSW	12	52518742	missense	possibly damaging	0.84
R6448:Arhgap5	UTSW	12	52517663	missense	probably benign	0.11
R6887:Arhgap5	UTSW	12	52519144	missense	probably benign
R7009:Arhgap5	UTSW	12	52519639	missense	probably benign	0.03
R7013:Arhgap5	UTSW	12	52518326	missense	probably benign	0.05
R7239:Arhgap5	UTSW	12	52517376	missense	probably benign
R7310:Arhgap5	UTSW	12	52542487	critical splice acceptor site	probably null
R7339:Arhgap5	UTSW	12	52517698	missense	possibly damaging	0.64
R7375:Arhgap5	UTSW	12	52516582	nonsense	probably null
R7421:Arhgap5	UTSW	12	52518000	missense	probably benign	0.42
R7442:Arhgap5	UTSW	12	52516956	missense	probably benign	0.25
R7842:Arhgap5	UTSW	12	52518697	missense	possibly damaging	0.78
R8079:Arhgap5	UTSW	12	52567205	missense	probably benign
R8241:Arhgap5	UTSW	12	52518315	missense	probably benign	0.00
R8419:Arhgap5	UTSW	12	52518789	missense	probably damaging	1.00
R9138:Arhgap5	UTSW	12	52562363	missense	probably benign	0.05
X0018:Arhgap5	UTSW	12	52518397	missense	probably damaging	1.00
Z1176:Arhgap5	UTSW	12	52518463	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- ACTAAAGAAACATGCCTCAGTGG -3'
(R):5'- CTGATCTGAGATGCTTCGGTTC -3'

Sequencing Primer
(F):5'- CCTCAGTGGCCAATATTGTACAG -3'
(R):5'- GAGATGCTTCGGTTCTTATTTTTCC -3'

Posted On

2018-11-28