Incidental Mutation 'R6988:Arhgap5'
ID 543100
Institutional Source Beutler Lab
Gene Symbol Arhgap5
Ensembl Gene ENSMUSG00000035133
Gene Name Rho GTPase activating protein 5
Synonyms p190B, p190-B
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6988 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 52503972-52571975 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 52518125 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 626 (D626E)
Ref Sequence ENSEMBL: ENSMUSP00000151809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110725] [ENSMUST00000217820] [ENSMUST00000219443]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000110725
AA Change: D626E

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106353
Gene: ENSMUSG00000035133
AA Change: D626E

DomainStartEndE-ValueType
Pfam:Ras 142 248 5.3e-7 PFAM
FF 269 325 6.03e-12 SMART
FF 367 420 4.61e-8 SMART
FF 427 482 2.22e-10 SMART
FF 483 537 3.89e-6 SMART
low complexity region 1035 1053 N/A INTRINSIC
low complexity region 1224 1247 N/A INTRINSIC
RhoGAP 1273 1447 1.03e-73 SMART
low complexity region 1479 1496 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217820
Predicted Effect possibly damaging
Transcript: ENSMUST00000219443
AA Change: D626E

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency
MGI Phenotype Strain: 2179998
Lethality: D1-D2
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPase activating protein 5 negatively regulates RHO GTPases, a family which may mediate cytoskeleton changes by stimulating the hydrolysis of bound GTP. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes die at birth, are 30% smaller, do not inflate their lungs, and show a small thymus, abnormal adipocyte differentiation and brain defects in the corpus callosum, anterior commissure and lateral ventricles. Mutant MEFs show impaired adipogenesis but undergo myogenesis in response to IGF-1. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Gene trapped(3)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik T G 4: 137,454,579 (GRCm38) L15W probably damaging Het
4930550C14Rik G A 9: 53,411,756 (GRCm38) V31I possibly damaging Het
Aadacl4fm4 A G 4: 144,686,325 (GRCm38) F15S probably benign Het
Adgre1 C T 17: 57,408,445 (GRCm38) S255F probably benign Het
Aff4 T G 11: 53,398,237 (GRCm38) S404R probably damaging Het
Akr1c19 A T 13: 4,233,758 (GRCm38) probably benign Het
Ankrd31 T A 13: 96,878,249 (GRCm38) I1342K probably damaging Het
Arhgef1 G A 7: 24,916,923 (GRCm38) V332I probably benign Het
AY358078 A G 14: 51,826,187 (GRCm38) E430G probably damaging Het
B4gat1 T A 19: 5,040,434 (GRCm38) I395N probably benign Het
Bub1b T A 2: 118,636,830 (GRCm38) I878N probably damaging Het
Ccdc150 C T 1: 54,355,709 (GRCm38) Q745* probably null Het
Ccl19 A T 4: 42,754,885 (GRCm38) I87N probably damaging Het
Ces2g G C 8: 104,963,908 (GRCm38) G107A probably benign Het
Chpt1 A G 10: 88,488,406 (GRCm38) V180A probably damaging Het
Col2a1 T C 15: 98,004,454 (GRCm38) T14A unknown Het
Dnah7a T C 1: 53,582,625 (GRCm38) I1114V possibly damaging Het
Dnah7c T C 1: 46,666,213 (GRCm38) I2462T possibly damaging Het
Dnah8 T C 17: 30,643,275 (GRCm38) F208S probably damaging Het
Dnhd1 A G 7: 105,714,210 (GRCm38) E3993G probably damaging Het
Erv3 C T 2: 131,855,966 (GRCm38) D158N possibly damaging Het
Exoc6 T A 19: 37,609,091 (GRCm38) F647I probably damaging Het
Fbrs G A 7: 127,479,508 (GRCm38) probably benign Het
Fgfr1op2 T C 6: 146,589,965 (GRCm38) F109L probably damaging Het
Fv1 T C 4: 147,869,271 (GRCm38) F98S possibly damaging Het
H2-M10.1 T C 17: 36,325,592 (GRCm38) K107E probably benign Het
Hspg2 A T 4: 137,528,890 (GRCm38) Q1436L probably damaging Het
Ighv1-74 T C 12: 115,802,763 (GRCm38) Y79C probably damaging Het
Kcnj1 G A 9: 32,396,585 (GRCm38) V102I probably benign Het
Mnt C A 11: 74,842,809 (GRCm38) probably benign Het
Mrpl15 T C 1: 4,782,660 (GRCm38) T112A probably benign Het
Ncdn T C 4: 126,747,189 (GRCm38) D506G probably benign Het
Ogdh C T 11: 6,313,806 (GRCm38) R81* probably null Het
Or6c2 T A 10: 129,526,673 (GRCm38) S149T probably benign Het
Or6c217 G C 10: 129,902,409 (GRCm38) F100L probably damaging Het
Pole G T 5: 110,329,583 (GRCm38) V1863F probably damaging Het
Pramel5 T C 4: 144,274,007 (GRCm38) probably benign Het
Rabep1 A G 11: 70,934,537 (GRCm38) K636E probably damaging Het
Rasgrf2 T A 13: 91,885,635 (GRCm38) Y1151F probably benign Het
Rrad A G 8: 104,630,636 (GRCm38) V93A probably damaging Het
Sesn3 A T 9: 14,310,257 (GRCm38) R118* probably null Het
Slc27a3 T C 3: 90,386,290 (GRCm38) N596S probably benign Het
Snx19 C A 9: 30,428,935 (GRCm38) D456E probably damaging Het
Spata31h1 T C 10: 82,291,899 (GRCm38) D1759G possibly damaging Het
Supt20 T C 3: 54,698,597 (GRCm38) S35P probably damaging Het
Syde2 G T 3: 146,019,809 (GRCm38) R885L probably benign Het
Synm G A 7: 67,733,658 (GRCm38) L1419F probably damaging Het
Tekt2 A G 4: 126,323,443 (GRCm38) F221L probably benign Het
Ticam1 C T 17: 56,269,900 (GRCm38) E732K probably benign Het
Tmem39b A G 4: 129,693,148 (GRCm38) I90T possibly damaging Het
Trgv6 G T 13: 19,190,644 (GRCm38) G40W possibly damaging Het
Trib2 A G 12: 15,815,338 (GRCm38) S79P probably damaging Het
Usp32 T C 11: 85,010,143 (GRCm38) M1084V probably benign Het
Vmn1r181 T C 7: 23,984,847 (GRCm38) F246L probably damaging Het
Wnt16 A G 6: 22,288,511 (GRCm38) D2G probably damaging Het
Zfp462 A G 4: 55,080,716 (GRCm38) E1357G probably benign Het
Zhx3 A G 2: 160,779,868 (GRCm38) M793T probably benign Het
Other mutations in Arhgap5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00679:Arhgap5 APN 12 52,517,281 (GRCm38) missense probably damaging 0.98
IGL00823:Arhgap5 APN 12 52,518,742 (GRCm38) missense possibly damaging 0.84
IGL01161:Arhgap5 APN 12 52,516,860 (GRCm38) missense probably damaging 1.00
IGL01360:Arhgap5 APN 12 52,518,240 (GRCm38) missense probably damaging 1.00
IGL01910:Arhgap5 APN 12 52,516,861 (GRCm38) missense probably benign 0.33
IGL02417:Arhgap5 APN 12 52,518,353 (GRCm38) missense probably damaging 0.99
IGL02448:Arhgap5 APN 12 52,562,340 (GRCm38) missense probably damaging 0.97
IGL02813:Arhgap5 APN 12 52,516,965 (GRCm38) missense probably benign 0.20
IGL03398:Arhgap5 APN 12 52,517,311 (GRCm38) missense probably damaging 0.99
Decline UTSW 12 52,516,582 (GRCm38) nonsense probably null
Pass UTSW 12 52,516,507 (GRCm38) missense possibly damaging 0.82
3-1:Arhgap5 UTSW 12 52,518,882 (GRCm38) missense possibly damaging 0.54
R0039:Arhgap5 UTSW 12 52,518,735 (GRCm38) nonsense probably null
R0088:Arhgap5 UTSW 12 52,516,548 (GRCm38) missense probably damaging 1.00
R0104:Arhgap5 UTSW 12 52,516,717 (GRCm38) missense probably damaging 1.00
R0111:Arhgap5 UTSW 12 52,559,960 (GRCm38) splice site probably benign
R0356:Arhgap5 UTSW 12 52,516,308 (GRCm38) missense probably damaging 1.00
R0616:Arhgap5 UTSW 12 52,517,065 (GRCm38) missense possibly damaging 0.79
R0707:Arhgap5 UTSW 12 52,518,168 (GRCm38) missense probably damaging 1.00
R0718:Arhgap5 UTSW 12 52,516,507 (GRCm38) missense possibly damaging 0.82
R0849:Arhgap5 UTSW 12 52,519,623 (GRCm38) missense probably benign 0.01
R0975:Arhgap5 UTSW 12 52,517,144 (GRCm38) missense possibly damaging 0.61
R1326:Arhgap5 UTSW 12 52,518,370 (GRCm38) missense possibly damaging 0.80
R1421:Arhgap5 UTSW 12 52,516,848 (GRCm38) missense probably damaging 1.00
R1422:Arhgap5 UTSW 12 52,519,514 (GRCm38) missense probably damaging 1.00
R1625:Arhgap5 UTSW 12 52,517,376 (GRCm38) missense probably benign
R1711:Arhgap5 UTSW 12 52,519,345 (GRCm38) missense probably damaging 1.00
R1970:Arhgap5 UTSW 12 52,542,593 (GRCm38) missense probably damaging 1.00
R2004:Arhgap5 UTSW 12 52,518,034 (GRCm38) missense probably benign 0.05
R2356:Arhgap5 UTSW 12 52,519,147 (GRCm38) missense probably benign 0.00
R3792:Arhgap5 UTSW 12 52,519,888 (GRCm38) missense probably benign 0.21
R3808:Arhgap5 UTSW 12 52,567,187 (GRCm38) missense possibly damaging 0.72
R4458:Arhgap5 UTSW 12 52,517,957 (GRCm38) missense probably benign
R4703:Arhgap5 UTSW 12 52,517,583 (GRCm38) missense probably damaging 0.99
R4736:Arhgap5 UTSW 12 52,519,077 (GRCm38) missense probably benign 0.00
R4737:Arhgap5 UTSW 12 52,519,077 (GRCm38) missense probably benign 0.00
R4740:Arhgap5 UTSW 12 52,519,077 (GRCm38) missense probably benign 0.00
R4768:Arhgap5 UTSW 12 52,557,492 (GRCm38) missense probably damaging 1.00
R4806:Arhgap5 UTSW 12 52,518,703 (GRCm38) missense probably damaging 0.99
R4817:Arhgap5 UTSW 12 52,519,209 (GRCm38) missense possibly damaging 0.71
R5586:Arhgap5 UTSW 12 52,519,912 (GRCm38) missense possibly damaging 0.95
R5681:Arhgap5 UTSW 12 52,519,779 (GRCm38) missense probably benign 0.21
R5683:Arhgap5 UTSW 12 52,519,586 (GRCm38) missense probably benign
R5911:Arhgap5 UTSW 12 52,518,742 (GRCm38) missense possibly damaging 0.84
R6448:Arhgap5 UTSW 12 52,517,663 (GRCm38) missense probably benign 0.11
R6887:Arhgap5 UTSW 12 52,519,144 (GRCm38) missense probably benign
R7009:Arhgap5 UTSW 12 52,519,639 (GRCm38) missense probably benign 0.03
R7013:Arhgap5 UTSW 12 52,518,326 (GRCm38) missense probably benign 0.05
R7239:Arhgap5 UTSW 12 52,517,376 (GRCm38) missense probably benign
R7310:Arhgap5 UTSW 12 52,542,487 (GRCm38) critical splice acceptor site probably null
R7339:Arhgap5 UTSW 12 52,517,698 (GRCm38) missense possibly damaging 0.64
R7375:Arhgap5 UTSW 12 52,516,582 (GRCm38) nonsense probably null
R7421:Arhgap5 UTSW 12 52,518,000 (GRCm38) missense probably benign 0.42
R7442:Arhgap5 UTSW 12 52,516,956 (GRCm38) missense probably benign 0.25
R7842:Arhgap5 UTSW 12 52,518,697 (GRCm38) missense possibly damaging 0.78
R8079:Arhgap5 UTSW 12 52,567,205 (GRCm38) missense probably benign
R8241:Arhgap5 UTSW 12 52,518,315 (GRCm38) missense probably benign 0.00
R8419:Arhgap5 UTSW 12 52,518,789 (GRCm38) missense probably damaging 1.00
R9138:Arhgap5 UTSW 12 52,562,363 (GRCm38) missense probably benign 0.05
X0018:Arhgap5 UTSW 12 52,518,397 (GRCm38) missense probably damaging 1.00
Z1176:Arhgap5 UTSW 12 52,518,463 (GRCm38) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ACTAAAGAAACATGCCTCAGTGG -3'
(R):5'- CTGATCTGAGATGCTTCGGTTC -3'

Sequencing Primer
(F):5'- CCTCAGTGGCCAATATTGTACAG -3'
(R):5'- GAGATGCTTCGGTTCTTATTTTTCC -3'
Posted On 2018-11-28