Incidental Mutation 'R6988:AY358078'
ID543106
Institutional Source Beutler Lab
Gene Symbol AY358078
Ensembl Gene ENSMUSG00000050961
Gene NamecDNA sequence AY358078
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R6988 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location51800046-51826359 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51826187 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 430 (E430G)
Ref Sequence ENSEMBL: ENSMUSP00000078129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053821]
Predicted Effect probably damaging
Transcript: ENSMUST00000053821
AA Change: E430G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000078129
Gene: ENSMUSG00000050961
AA Change: E430G

DomainStartEndE-ValueType
Pfam:Takusan 91 171 5.5e-26 PFAM
coiled coil region 187 220 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik T G 4: 137,454,579 L15W probably damaging Het
4930550C14Rik G A 9: 53,411,756 V31I possibly damaging Het
4932415D10Rik T C 10: 82,291,899 D1759G possibly damaging Het
Adgre1 C T 17: 57,408,445 S255F probably benign Het
Aff4 T G 11: 53,398,237 S404R probably damaging Het
Akr1c19 A T 13: 4,233,758 probably benign Het
Ankrd31 T A 13: 96,878,249 I1342K probably damaging Het
Arhgap5 T A 12: 52,518,125 D626E possibly damaging Het
Arhgef1 G A 7: 24,916,923 V332I probably benign Het
B4gat1 T A 19: 5,040,434 I395N probably benign Het
Bub1b T A 2: 118,636,830 I878N probably damaging Het
Ccdc150 C T 1: 54,355,709 Q745* probably null Het
Ccl19 A T 4: 42,754,885 I87N probably damaging Het
Ces2g G C 8: 104,963,908 G107A probably benign Het
Chpt1 A G 10: 88,488,406 V180A probably damaging Het
Col2a1 T C 15: 98,004,454 T14A unknown Het
Dnah7a T C 1: 53,582,625 I1114V possibly damaging Het
Dnah7c T C 1: 46,666,213 I2462T possibly damaging Het
Dnah8 T C 17: 30,643,275 F208S probably damaging Het
Dnhd1 A G 7: 105,714,210 E3993G probably damaging Het
Erv3 C T 2: 131,855,966 D158N possibly damaging Het
Exoc6 T A 19: 37,609,091 F647I probably damaging Het
Fbrs G A 7: 127,479,508 probably benign Het
Fgfr1op2 T C 6: 146,589,965 F109L probably damaging Het
Fv1 T C 4: 147,869,271 F98S possibly damaging Het
Gm436 A G 4: 144,686,325 F15S probably benign Het
H2-M10.1 T C 17: 36,325,592 K107E probably benign Het
Hspg2 A T 4: 137,528,890 Q1436L probably damaging Het
Ighv1-74 T C 12: 115,802,763 Y79C probably damaging Het
Kcnj1 G A 9: 32,396,585 V102I probably benign Het
Mnt C A 11: 74,842,809 probably benign Het
Mrpl15 T C 1: 4,782,660 T112A probably benign Het
Ncdn T C 4: 126,747,189 D506G probably benign Het
Ogdh C T 11: 6,313,806 R81* probably null Het
Olfr791 T A 10: 129,526,673 S149T probably benign Het
Olfr815 G C 10: 129,902,409 F100L probably damaging Het
Pole G T 5: 110,329,583 V1863F probably damaging Het
Pramel5 T C 4: 144,274,007 probably benign Het
Rabep1 A G 11: 70,934,537 K636E probably damaging Het
Rasgrf2 T A 13: 91,885,635 Y1151F probably benign Het
Rrad A G 8: 104,630,636 V93A probably damaging Het
Sesn3 A T 9: 14,310,257 R118* probably null Het
Slc27a3 T C 3: 90,386,290 N596S probably benign Het
Snx19 C A 9: 30,428,935 D456E probably damaging Het
Supt20 T C 3: 54,698,597 S35P probably damaging Het
Syde2 G T 3: 146,019,809 R885L probably benign Het
Synm G A 7: 67,733,658 L1419F probably damaging Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Tekt2 A G 4: 126,323,443 F221L probably benign Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Tmem39b A G 4: 129,693,148 I90T possibly damaging Het
Trib2 A G 12: 15,815,338 S79P probably damaging Het
Usp32 T C 11: 85,010,143 M1084V probably benign Het
Vmn1r181 T C 7: 23,984,847 F246L probably damaging Het
Wnt16 A G 6: 22,288,511 D2G probably damaging Het
Zfp462 A G 4: 55,080,716 E1357G probably benign Het
Zhx3 A G 2: 160,779,868 M793T probably benign Het
Other mutations in AY358078
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:AY358078 APN 14 51805709 splice site probably benign
IGL02053:AY358078 APN 14 51805552 missense unknown
IGL02057:AY358078 APN 14 51820305 missense unknown
IGL02498:AY358078 APN 14 51803487 missense probably benign 0.00
FR4737:AY358078 UTSW 14 51805698 missense unknown
R0140:AY358078 UTSW 14 51825942 missense probably benign 0.12
R0466:AY358078 UTSW 14 51805632 missense unknown
R0496:AY358078 UTSW 14 51803532 missense unknown
R1546:AY358078 UTSW 14 51820419 splice site probably null
R1793:AY358078 UTSW 14 51804594 missense unknown
R1867:AY358078 UTSW 14 51800047 start codon destroyed probably null 0.01
R1993:AY358078 UTSW 14 51826062 missense probably damaging 1.00
R1994:AY358078 UTSW 14 51826062 missense probably damaging 1.00
R1995:AY358078 UTSW 14 51826062 missense probably damaging 1.00
R2184:AY358078 UTSW 14 51825988 missense probably damaging 1.00
R2322:AY358078 UTSW 14 51804690 missense unknown
R2441:AY358078 UTSW 14 51800089 missense probably benign 0.00
R3851:AY358078 UTSW 14 51805553 missense unknown
R3852:AY358078 UTSW 14 51805553 missense unknown
R4600:AY358078 UTSW 14 51826075 missense possibly damaging 0.89
R4603:AY358078 UTSW 14 51826075 missense possibly damaging 0.89
R4610:AY358078 UTSW 14 51826075 missense possibly damaging 0.89
R4611:AY358078 UTSW 14 51826075 missense possibly damaging 0.89
R4916:AY358078 UTSW 14 51802651 missense unknown
R5096:AY358078 UTSW 14 51826118 missense probably benign 0.19
R5143:AY358078 UTSW 14 51802549 missense unknown
R5609:AY358078 UTSW 14 51804608 missense unknown
R5651:AY358078 UTSW 14 51822160 missense unknown
R6345:AY358078 UTSW 14 51826292 missense probably damaging 1.00
R7340:AY358078 UTSW 14 51826259 missense probably damaging 1.00
R8432:AY358078 UTSW 14 51822178 missense unknown
RF002:AY358078 UTSW 14 51805593 nonsense probably null
RF017:AY358078 UTSW 14 51805593 nonsense probably null
RF025:AY358078 UTSW 14 51805589 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAACGTTTGAATCCACCCGG -3'
(R):5'- CCCCAGCTCATTTGAGTTAAAG -3'

Sequencing Primer
(F):5'- AGACCAGTGACATATTTGGGTCCC -3'
(R):5'- CCCAGCTCATTTGAGTTAAAGGAAAC -3'
Posted On2018-11-28