Incidental Mutation 'R6988:B4gat1'
ID 543112
Institutional Source Beutler Lab
Gene Symbol B4gat1
Ensembl Gene ENSMUSG00000047379
Gene Name beta-1,4-glucuronyltransferase 1
Synonyms B3gnt1, B3gnt6, iGNT, 1500032M01Rik, BETA3GNT1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6988 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 5038826-5041134 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 5040434 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 395 (I395N)
Ref Sequence ENSEMBL: ENSMUSP00000062016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053705] [ENSMUST00000116567]
AlphaFold Q8BWP8
Predicted Effect probably benign
Transcript: ENSMUST00000053705
AA Change: I395N

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000062016
Gene: ENSMUSG00000047379
AA Change: I395N

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 39 49 N/A INTRINSIC
Pfam:Glyco_transf_49 94 409 3.8e-106 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116567
SMART Domains Protein: ENSMUSP00000112266
Gene: ENSMUSG00000080268

DomainStartEndE-ValueType
low complexity region 29 59 N/A INTRINSIC
Pfam:Sds3 60 209 5.3e-23 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta-1,3-N-acetylglucosaminyltransferase family. This enzyme is a type II transmembrane protein. It is essential for the synthesis of poly-N-acetyllactosamine, a determinant for the blood group i antigen. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display altered lymphocyte rolling and abnormal lymph node B and T cell numbers. Mice homozygous for a hypomorphic allele exhibit mild muscular dystrophy, abnormal axon guidance and fasciculation and abnormal dorsal funiculus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik T G 4: 137,454,579 L15W probably damaging Het
4930550C14Rik G A 9: 53,411,756 V31I possibly damaging Het
4932415D10Rik T C 10: 82,291,899 D1759G possibly damaging Het
Adgre1 C T 17: 57,408,445 S255F probably benign Het
Aff4 T G 11: 53,398,237 S404R probably damaging Het
Akr1c19 A T 13: 4,233,758 probably benign Het
Ankrd31 T A 13: 96,878,249 I1342K probably damaging Het
Arhgap5 T A 12: 52,518,125 D626E possibly damaging Het
Arhgef1 G A 7: 24,916,923 V332I probably benign Het
AY358078 A G 14: 51,826,187 E430G probably damaging Het
Bub1b T A 2: 118,636,830 I878N probably damaging Het
Ccdc150 C T 1: 54,355,709 Q745* probably null Het
Ccl19 A T 4: 42,754,885 I87N probably damaging Het
Ces2g G C 8: 104,963,908 G107A probably benign Het
Chpt1 A G 10: 88,488,406 V180A probably damaging Het
Col2a1 T C 15: 98,004,454 T14A unknown Het
Dnah7a T C 1: 53,582,625 I1114V possibly damaging Het
Dnah7c T C 1: 46,666,213 I2462T possibly damaging Het
Dnah8 T C 17: 30,643,275 F208S probably damaging Het
Dnhd1 A G 7: 105,714,210 E3993G probably damaging Het
Erv3 C T 2: 131,855,966 D158N possibly damaging Het
Exoc6 T A 19: 37,609,091 F647I probably damaging Het
Fbrs G A 7: 127,479,508 probably benign Het
Fgfr1op2 T C 6: 146,589,965 F109L probably damaging Het
Fv1 T C 4: 147,869,271 F98S possibly damaging Het
Gm436 A G 4: 144,686,325 F15S probably benign Het
H2-M10.1 T C 17: 36,325,592 K107E probably benign Het
Hspg2 A T 4: 137,528,890 Q1436L probably damaging Het
Ighv1-74 T C 12: 115,802,763 Y79C probably damaging Het
Kcnj1 G A 9: 32,396,585 V102I probably benign Het
Mnt C A 11: 74,842,809 probably benign Het
Mrpl15 T C 1: 4,782,660 T112A probably benign Het
Ncdn T C 4: 126,747,189 D506G probably benign Het
Ogdh C T 11: 6,313,806 R81* probably null Het
Olfr791 T A 10: 129,526,673 S149T probably benign Het
Olfr815 G C 10: 129,902,409 F100L probably damaging Het
Pole G T 5: 110,329,583 V1863F probably damaging Het
Pramel5 T C 4: 144,274,007 probably benign Het
Rabep1 A G 11: 70,934,537 K636E probably damaging Het
Rasgrf2 T A 13: 91,885,635 Y1151F probably benign Het
Rrad A G 8: 104,630,636 V93A probably damaging Het
Sesn3 A T 9: 14,310,257 R118* probably null Het
Slc27a3 T C 3: 90,386,290 N596S probably benign Het
Snx19 C A 9: 30,428,935 D456E probably damaging Het
Supt20 T C 3: 54,698,597 S35P probably damaging Het
Syde2 G T 3: 146,019,809 R885L probably benign Het
Synm G A 7: 67,733,658 L1419F probably damaging Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Tekt2 A G 4: 126,323,443 F221L probably benign Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Tmem39b A G 4: 129,693,148 I90T possibly damaging Het
Trib2 A G 12: 15,815,338 S79P probably damaging Het
Usp32 T C 11: 85,010,143 M1084V probably benign Het
Vmn1r181 T C 7: 23,984,847 F246L probably damaging Het
Wnt16 A G 6: 22,288,511 D2G probably damaging Het
Zfp462 A G 4: 55,080,716 E1357G probably benign Het
Zhx3 A G 2: 160,779,868 M793T probably benign Het
Other mutations in B4gat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01322:B4gat1 APN 19 5040009 missense probably damaging 1.00
IGL02322:B4gat1 APN 19 5039127 missense possibly damaging 0.92
IGL02339:B4gat1 APN 19 5039418 missense probably benign
IGL02717:B4gat1 APN 19 5038969 unclassified probably benign
R0063:B4gat1 UTSW 19 5039707 nonsense probably null
R0827:B4gat1 UTSW 19 5039697 missense possibly damaging 0.65
R5888:B4gat1 UTSW 19 5039532 missense probably benign 0.38
R5901:B4gat1 UTSW 19 5039213 nonsense probably null
R6535:B4gat1 UTSW 19 5039530 missense possibly damaging 0.54
R7342:B4gat1 UTSW 19 5039658 missense probably benign 0.03
R8967:B4gat1 UTSW 19 5039650 missense probably damaging 1.00
R9057:B4gat1 UTSW 19 5039028 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- GGGCCCTGGGGATATCATTAAG -3'
(R):5'- GCTATCCACCCAACATGGTTAATAG -3'

Sequencing Primer
(F):5'- CCCTGGGGATATCATTAAGTTATTG -3'
(R):5'- CATCTGAGCCAACAGTTCTGTGAG -3'
Posted On 2018-11-28