Mutagenetix > Incidental Mutations

Incidental Mutation 'R6988:Exoc6'

543113

Institutional Source

Beutler Lab

Gene Symbol

Exoc6

Ensembl Gene

ENSMUSG00000053799

Gene Name

exocyst complex component 6

Synonyms

msec15, Sec15l1, 4833405E05Rik, Sec15, hbd

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6988 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

37550418-37683245 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 37609091 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 647 (F647I)

Ref Sequence

ENSEMBL: ENSMUSP00000064332 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066439]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000066439
AA Change: F647I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000064332
Gene: ENSMUSG00000053799
AA Change: F647I

Domain	Start	End	E-Value	Type
low complexity region	265	273	N/A	INTRINSIC
Pfam:Sec15	456	762	8.1e-109	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to the Saccharomyces cerevisiae SEC15 gene product, which is essential for vesicular traffic from the Golgi apparatus to the cell surface in yeast. It is one of the components of a multiprotein complex required for exocytosis. The 5' portion of this gene and two neighboring cytochrome p450 genes are included in a deletion that results in an autosomal-dominant form of nonsyndromic optic nerve aplasia (ONA). Alternative splicing and the use of alternative promoters results in multiple transcript variants. A paralogous gene encoding a similar protein is present on chromosome 2. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit severe microcytic anemia, erythrocyte hyperchromia, and markedly increased levels of red cell protoporphyrin. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700013G24Rik	T	G	4: 137,454,579	L15W	probably damaging	Het
4930550C14Rik	G	A	9: 53,411,756	V31I	possibly damaging	Het
4932415D10Rik	T	C	10: 82,291,899	D1759G	possibly damaging	Het
Adgre1	C	T	17: 57,408,445	S255F	probably benign	Het
Aff4	T	G	11: 53,398,237	S404R	probably damaging	Het
Akr1c19	A	T	13: 4,233,758		probably benign	Het
Ankrd31	T	A	13: 96,878,249	I1342K	probably damaging	Het
Arhgap5	T	A	12: 52,518,125	D626E	possibly damaging	Het
Arhgef1	G	A	7: 24,916,923	V332I	probably benign	Het
AY358078	A	G	14: 51,826,187	E430G	probably damaging	Het
B4gat1	T	A	19: 5,040,434	I395N	probably benign	Het
Bub1b	T	A	2: 118,636,830	I878N	probably damaging	Het
Ccdc150	C	T	1: 54,355,709	Q745*	probably null	Het
Ccl19	A	T	4: 42,754,885	I87N	probably damaging	Het
Ces2g	G	C	8: 104,963,908	G107A	probably benign	Het
Chpt1	A	G	10: 88,488,406	V180A	probably damaging	Het
Col2a1	T	C	15: 98,004,454	T14A	unknown	Het
Dnah7a	T	C	1: 53,582,625	I1114V	possibly damaging	Het
Dnah7c	T	C	1: 46,666,213	I2462T	possibly damaging	Het
Dnah8	T	C	17: 30,643,275	F208S	probably damaging	Het
Dnhd1	A	G	7: 105,714,210	E3993G	probably damaging	Het
Erv3	C	T	2: 131,855,966	D158N	possibly damaging	Het
Fbrs	G	A	7: 127,479,508		probably benign	Het
Fgfr1op2	T	C	6: 146,589,965	F109L	probably damaging	Het
Fv1	T	C	4: 147,869,271	F98S	possibly damaging	Het
Gm436	A	G	4: 144,686,325	F15S	probably benign	Het
H2-M10.1	T	C	17: 36,325,592	K107E	probably benign	Het
Hspg2	A	T	4: 137,528,890	Q1436L	probably damaging	Het
Ighv1-74	T	C	12: 115,802,763	Y79C	probably damaging	Het
Kcnj1	G	A	9: 32,396,585	V102I	probably benign	Het
Mnt	C	A	11: 74,842,809		probably benign	Het
Mrpl15	T	C	1: 4,782,660	T112A	probably benign	Het
Ncdn	T	C	4: 126,747,189	D506G	probably benign	Het
Ogdh	C	T	11: 6,313,806	R81*	probably null	Het
Olfr791	T	A	10: 129,526,673	S149T	probably benign	Het
Olfr815	G	C	10: 129,902,409	F100L	probably damaging	Het
Pole	G	T	5: 110,329,583	V1863F	probably damaging	Het
Pramel5	T	C	4: 144,274,007		probably benign	Het
Rabep1	A	G	11: 70,934,537	K636E	probably damaging	Het
Rasgrf2	T	A	13: 91,885,635	Y1151F	probably benign	Het
Rrad	A	G	8: 104,630,636	V93A	probably damaging	Het
Sesn3	A	T	9: 14,310,257	R118*	probably null	Het
Slc27a3	T	C	3: 90,386,290	N596S	probably benign	Het
Snx19	C	A	9: 30,428,935	D456E	probably damaging	Het
Supt20	T	C	3: 54,698,597	S35P	probably damaging	Het
Syde2	G	T	3: 146,019,809	R885L	probably benign	Het
Synm	G	A	7: 67,733,658	L1419F	probably damaging	Het
Tcrg-V6	G	T	13: 19,190,644	G40W	possibly damaging	Het
Tekt2	A	G	4: 126,323,443	F221L	probably benign	Het
Ticam1	C	T	17: 56,269,900	E732K	probably benign	Het
Tmem39b	A	G	4: 129,693,148	I90T	possibly damaging	Het
Trib2	A	G	12: 15,815,338	S79P	probably damaging	Het
Usp32	T	C	11: 85,010,143	M1084V	probably benign	Het
Vmn1r181	T	C	7: 23,984,847	F246L	probably damaging	Het
Wnt16	A	G	6: 22,288,511	D2G	probably damaging	Het
Zfp462	A	G	4: 55,080,716	E1357G	probably benign	Het
Zhx3	A	G	2: 160,779,868	M793T	probably benign	Het

Other mutations in Exoc6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01432:Exoc6	APN	19	37589876	missense	possibly damaging	0.68
IGL01716:Exoc6	APN	19	37682964	missense	probably damaging	0.98
IGL02363:Exoc6	APN	19	37608954	missense	probably damaging	1.00
IGL02383:Exoc6	APN	19	37578474	missense	probably benign
IGL03394:Exoc6	APN	19	37599572	missense	probably benign	0.15
australamerican	UTSW	19	37598679	critical splice donor site	probably null
IGL03046:Exoc6	UTSW	19	37593769	critical splice donor site	probably null
R1156:Exoc6	UTSW	19	37682897	missense	probably benign	0.05
R1489:Exoc6	UTSW	19	37597120	missense	possibly damaging	0.71
R1747:Exoc6	UTSW	19	37639769	splice site	probably null
R2125:Exoc6	UTSW	19	37590941	missense	probably damaging	1.00
R2863:Exoc6	UTSW	19	37653413	missense	probably benign	0.34
R4090:Exoc6	UTSW	19	37571912	missense	probably benign
R4666:Exoc6	UTSW	19	37570505	missense	probably damaging	0.97
R4674:Exoc6	UTSW	19	37609082	missense	probably damaging	1.00
R5382:Exoc6	UTSW	19	37598679	critical splice donor site	probably null
R5471:Exoc6	UTSW	19	37599617	missense	probably benign	0.30
R5533:Exoc6	UTSW	19	37593770	splice site	probably null
R5607:Exoc6	UTSW	19	37578529	missense	probably benign	0.01
R5641:Exoc6	UTSW	19	37587633	splice site	probably null
R5759:Exoc6	UTSW	19	37573741	nonsense	probably null
R5889:Exoc6	UTSW	19	37582245	missense	probably damaging	1.00
R6592:Exoc6	UTSW	19	37571912	missense	probably benign
R6936:Exoc6	UTSW	19	37571863	missense	probably benign	0.00
R7088:Exoc6	UTSW	19	37577010	missense	probably damaging	0.99
R7162:Exoc6	UTSW	19	37577118	missense	probably damaging	0.97
R7948:Exoc6	UTSW	19	37576974	missense	probably benign	0.00
R8266:Exoc6	UTSW	19	37577049	missense	probably benign	0.00
R8525:Exoc6	UTSW	19	37608992	missense	possibly damaging	0.53
R8917:Exoc6	UTSW	19	37589912	missense	probably benign	0.35
R9003:Exoc6	UTSW	19	37598649	missense	probably damaging	1.00
R9159:Exoc6	UTSW	19	37609030	missense	probably benign	0.00
R9435:Exoc6	UTSW	19	37597097	missense	probably benign	0.00
RF009:Exoc6	UTSW	19	37571620	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCTCTCAGGATGCTCGACATG -3'
(R):5'- CCTTCACACAGGCTCCTTTTAAAG -3'

Sequencing Primer
(F):5'- ATGCTCGACATGCGGCAG -3'
(R):5'- CTGTTAATTTCAGAAGTTTGCTTTGC -3'

Posted On

2018-11-28