Incidental Mutation 'R6989:Trpv6'
List |< first << previous [record 59 of 66] next >> last >|
ID543135
Institutional Source Beutler Lab
Gene Symbol Trpv6
Ensembl Gene ENSMUSG00000029868
Gene Nametransient receptor potential cation channel, subfamily V, member 6
SynonymsCAT, Ecac2, CaT1, Cac
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R6989 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location41620624-41636405 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 41625456 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 332 (L332Q)
Ref Sequence ENSEMBL: ENSMUSP00000031902 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031902] [ENSMUST00000114732] [ENSMUST00000201471]
Predicted Effect probably damaging
Transcript: ENSMUST00000031902
AA Change: L332Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031902
Gene: ENSMUSG00000029868
AA Change: L332Q

DomainStartEndE-ValueType
ANK 44 74 2.39e2 SMART
ANK 78 107 6.17e-1 SMART
ANK 116 145 3.06e-5 SMART
ANK 162 191 1.85e-4 SMART
Blast:ANK 195 223 3e-10 BLAST
ANK 238 267 2.47e2 SMART
Pfam:Ion_trans 327 589 9.8e-18 PFAM
low complexity region 680 695 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114732
SMART Domains Protein: ENSMUSP00000110380
Gene: ENSMUSG00000029869

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
EPH_lbd 34 227 2.18e-100 SMART
low complexity region 242 255 N/A INTRINSIC
Pfam:GCC2_GCC3 299 341 1.9e-9 PFAM
FN3 365 462 3.59e-3 SMART
FN3 481 562 3.73e-10 SMART
Pfam:EphA2_TM 589 660 3.4e-16 PFAM
Pfam:Pkinase 663 908 1.4e-29 PFAM
Pfam:Pkinase_Tyr 663 908 1.1e-67 PFAM
SAM 938 1005 1e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167497
Predicted Effect
SMART Domains Protein: ENSMUSP00000143854
Gene: ENSMUSG00000029868
AA Change: L332Q

DomainStartEndE-ValueType
ANK 44 74 2.39e2 SMART
ANK 78 107 6.17e-1 SMART
ANK 116 145 3.06e-5 SMART
ANK 162 191 1.85e-4 SMART
Blast:ANK 195 223 3e-10 BLAST
ANK 238 267 2.47e2 SMART
Pfam:Ion_trans 327 589 9.8e-18 PFAM
low complexity region 680 695 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of multipass membrane proteins that functions as calcium channels. The encoded protein contains N-terminal ankyrin repeats, which are required for channel assembly and regulation. Translation initiation for this protein occurs at a non-AUG start codon that is decoded as methionine. This gene is situated next to a closely related gene for transient receptor potential cation channel subfamily V member 5 (TRPV5). This locus has experienced positive selection in non-African populations, resulting in several non-synonymous codon differences among individuals of different genetic backgrounds. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit impaired sperm motility and decreased fertilization by sperm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921536K21Rik C T 11: 3,890,076 R107H probably damaging Het
4930438A08Rik T C 11: 58,287,402 V96A possibly damaging Het
Abcc2 A G 19: 43,832,172 D1370G probably damaging Het
Abcc9 T A 6: 142,688,981 N186Y probably damaging Het
Adcy7 T C 8: 88,308,786 V106A probably benign Het
Adgra3 A G 5: 50,006,884 F251S probably damaging Het
Akr1c6 T A 13: 4,449,046 I33N probably damaging Het
Alk A C 17: 71,897,952 M1075R probably benign Het
Amh A G 10: 80,805,504 Q86R probably benign Het
Aox1 T C 1: 58,085,452 Y951H probably damaging Het
Arhgap26 G T 18: 39,099,629 R119L probably damaging Het
Arl8a A G 1: 135,146,997 K7R probably benign Het
Birc6 T G 17: 74,630,989 S2638A probably benign Het
Ccdc162 T G 10: 41,581,353 Q256H probably damaging Het
Cenpe T A 3: 135,235,127 L679Q probably damaging Het
Cpa5 T A 6: 30,625,892 H203Q probably benign Het
Cpne9 A T 6: 113,300,583 D421V possibly damaging Het
Cux1 A T 5: 136,279,648 C1212* probably null Het
Dock9 G A 14: 121,627,379 H736Y probably damaging Het
Dpp3 A T 19: 4,921,167 V214E probably damaging Het
Dtx3 T C 10: 127,192,877 E161G probably benign Het
Ect2 A T 3: 27,102,488 Y774* probably null Het
Enpep G T 3: 129,280,950 P717H probably damaging Het
Erich3 A T 3: 154,763,677 probably benign Het
Fbp2 C T 13: 62,858,177 A41T probably damaging Het
Fbxl21 T C 13: 56,527,061 V75A probably damaging Het
Fkbp5 C T 17: 28,415,945 D197N probably benign Het
Fsip2 A G 2: 82,976,954 T1206A probably benign Het
Ggt7 A G 2: 155,503,460 V156A probably benign Het
Gm15448 T A 7: 3,822,164 Y493F possibly damaging Het
Gpi1 T C 7: 34,202,520 K156R probably damaging Het
Gpx5 T C 13: 21,287,499 D178G probably damaging Het
Grm7 G A 6: 111,207,805 E366K probably damaging Het
Haao T C 17: 83,831,674 Q277R probably damaging Het
Lama1 T C 17: 67,753,758 S694P Het
Lrp10 A G 14: 54,468,493 D380G probably benign Het
Lrp2 C A 2: 69,472,455 D2977Y probably damaging Het
Map2 T A 1: 66,414,906 M985K probably benign Het
Met C A 6: 17,535,928 N784K possibly damaging Het
Met T A 6: 17,535,929 Y65N probably damaging Het
Muc6 T G 7: 141,639,979 probably benign Het
Numbl T A 7: 27,280,840 W416R probably damaging Het
Nup160 G A 2: 90,707,020 S746N probably benign Het
Pcca G A 14: 122,650,288 G102D probably damaging Het
Psmc2 T A 5: 21,801,219 F243L possibly damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rpn1 G T 6: 88,099,303 V357L probably benign Het
Rtn3 A G 19: 7,456,491 F712S possibly damaging Het
Scgb1b10 T A 7: 32,101,149 D54E probably benign Het
Scn5a A G 9: 119,486,329 I1771T probably damaging Het
Sec14l1 A G 11: 117,156,394 I633V probably damaging Het
Slc17a6 T C 7: 51,661,476 Y313H possibly damaging Het
Slc18a1 G A 8: 69,038,862 T500I probably benign Het
Slx4 G A 16: 3,995,838 A93V probably damaging Het
Stat4 T C 1: 52,068,815 S148P probably benign Het
Tbc1d15 A T 10: 115,209,569 C497S probably damaging Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Trav3-3 C A 14: 53,666,345 P40Q possibly damaging Het
Ube2t T G 1: 134,969,295 V55G probably damaging Het
Ufm1 T C 3: 53,857,981 K69E probably damaging Het
Utp20 T C 10: 88,778,240 D1284G probably benign Het
Vil1 C T 1: 74,423,954 T432I probably damaging Het
Vps13b T A 15: 35,448,581 I567K probably benign Het
Zfp236 A T 18: 82,628,363 V1023D probably damaging Het
Zfp429 A G 13: 67,389,961 Y455H probably benign Het
Other mutations in Trpv6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01878:Trpv6 APN 6 41626867 splice site probably benign
IGL02033:Trpv6 APN 6 41627617 splice site probably benign
IGL02439:Trpv6 APN 6 41625487 missense probably damaging 1.00
R0973:Trpv6 UTSW 6 41625188 missense probably benign 0.01
R0973:Trpv6 UTSW 6 41625188 missense probably benign 0.01
R0974:Trpv6 UTSW 6 41625188 missense probably benign 0.01
R1385:Trpv6 UTSW 6 41621129 missense probably benign 0.32
R1696:Trpv6 UTSW 6 41621768 missense possibly damaging 0.95
R2095:Trpv6 UTSW 6 41621756 missense probably damaging 0.99
R2287:Trpv6 UTSW 6 41626111 missense probably damaging 1.00
R2298:Trpv6 UTSW 6 41636076 missense possibly damaging 0.62
R2519:Trpv6 UTSW 6 41624616 nonsense probably null
R3522:Trpv6 UTSW 6 41627405 missense probably damaging 0.99
R4172:Trpv6 UTSW 6 41625498 missense probably damaging 1.00
R4397:Trpv6 UTSW 6 41625238 missense possibly damaging 0.82
R4568:Trpv6 UTSW 6 41626569 missense probably damaging 1.00
R4571:Trpv6 UTSW 6 41621744 missense probably damaging 1.00
R5547:Trpv6 UTSW 6 41636154 missense possibly damaging 0.68
R6344:Trpv6 UTSW 6 41625422 splice site probably null
R7427:Trpv6 UTSW 6 41625153 missense probably benign
R7445:Trpv6 UTSW 6 41621342 missense probably damaging 1.00
R7538:Trpv6 UTSW 6 41626167 missense probably benign 0.01
R7960:Trpv6 UTSW 6 41627678 missense probably benign 0.00
R8059:Trpv6 UTSW 6 41624586 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACAGCACATGGTAAAGCAG -3'
(R):5'- TGGGCTGTGCTATTCCATGC -3'

Sequencing Primer
(F):5'- TGTACAGCACATAGATGGCAC -3'
(R):5'- ATGCAGCTTTGAGTCCTGAC -3'
Posted On2018-11-28