Incidental Mutation 'R6989:Dtx3'
ID543153
Institutional Source Beutler Lab
Gene Symbol Dtx3
Ensembl Gene ENSMUSG00000040415
Gene Namedeltex 3, E3 ubiquitin ligase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.497) question?
Stock #R6989 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location127190378-127195728 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 127192877 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 161 (E161G)
Ref Sequence ENSEMBL: ENSMUSP00000111937 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013970] [ENSMUST00000019611] [ENSMUST00000038217] [ENSMUST00000116229] [ENSMUST00000130855] [ENSMUST00000137151] [ENSMUST00000144322] [ENSMUST00000167353] [ENSMUST00000218587] [ENSMUST00000218654] [ENSMUST00000219245] [ENSMUST00000222006]
Predicted Effect probably benign
Transcript: ENSMUST00000013970
SMART Domains Protein: ENSMUSP00000013970
Gene: ENSMUSG00000025417

DomainStartEndE-ValueType
low complexity region 7 25 N/A INTRINSIC
low complexity region 27 41 N/A INTRINSIC
PIPKc 72 420 2.3e-172 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000019611
SMART Domains Protein: ENSMUSP00000019611
Gene: ENSMUSG00000019467

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 81 103 N/A INTRINSIC
low complexity region 146 171 N/A INTRINSIC
RhoGEF 203 374 2.45e-49 SMART
PH 394 507 6.67e-1 SMART
low complexity region 561 569 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000038217
AA Change: E161G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000044627
Gene: ENSMUSG00000040415
AA Change: E161G

DomainStartEndE-ValueType
low complexity region 64 72 N/A INTRINSIC
coiled coil region 73 104 N/A INTRINSIC
low complexity region 119 154 N/A INTRINSIC
RING 164 202 1.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116229
AA Change: E161G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000111937
Gene: ENSMUSG00000040415
AA Change: E161G

DomainStartEndE-ValueType
low complexity region 64 72 N/A INTRINSIC
coiled coil region 73 104 N/A INTRINSIC
low complexity region 119 154 N/A INTRINSIC
RING 164 202 1.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130855
AA Change: E164G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000114776
Gene: ENSMUSG00000040415
AA Change: E164G

DomainStartEndE-ValueType
low complexity region 67 75 N/A INTRINSIC
coiled coil region 76 107 N/A INTRINSIC
low complexity region 122 157 N/A INTRINSIC
RING 167 205 1.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137151
Predicted Effect probably benign
Transcript: ENSMUST00000144322
SMART Domains Protein: ENSMUSP00000116510
Gene: ENSMUSG00000040415

DomainStartEndE-ValueType
low complexity region 67 75 N/A INTRINSIC
coiled coil region 76 107 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167353
SMART Domains Protein: ENSMUSP00000126339
Gene: ENSMUSG00000019467

DomainStartEndE-ValueType
low complexity region 72 94 N/A INTRINSIC
low complexity region 137 162 N/A INTRINSIC
RhoGEF 194 365 2.45e-49 SMART
PH 385 498 6.67e-1 SMART
low complexity region 552 560 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218587
Predicted Effect probably benign
Transcript: ENSMUST00000218654
Predicted Effect probably benign
Transcript: ENSMUST00000219245
Predicted Effect probably benign
Transcript: ENSMUST00000222006
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DTX3 functions as an E3 ubiquitin ligase (Takeyama et al., 2003 [PubMed 12670957]).[supplied by OMIM, Nov 2009]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921536K21Rik C T 11: 3,890,076 R107H probably damaging Het
4930438A08Rik T C 11: 58,287,402 V96A possibly damaging Het
Abcc2 A G 19: 43,832,172 D1370G probably damaging Het
Abcc9 T A 6: 142,688,981 N186Y probably damaging Het
Adcy7 T C 8: 88,308,786 V106A probably benign Het
Adgra3 A G 5: 50,006,884 F251S probably damaging Het
Akr1c6 T A 13: 4,449,046 I33N probably damaging Het
Alk A C 17: 71,897,952 M1075R probably benign Het
Amh A G 10: 80,805,504 Q86R probably benign Het
Aox1 T C 1: 58,085,452 Y951H probably damaging Het
Arhgap26 G T 18: 39,099,629 R119L probably damaging Het
Arl8a A G 1: 135,146,997 K7R probably benign Het
Birc6 T G 17: 74,630,989 S2638A probably benign Het
Ccdc162 T G 10: 41,581,353 Q256H probably damaging Het
Cenpe T A 3: 135,235,127 L679Q probably damaging Het
Cpa5 T A 6: 30,625,892 H203Q probably benign Het
Cpne9 A T 6: 113,300,583 D421V possibly damaging Het
Cux1 A T 5: 136,279,648 C1212* probably null Het
Dock9 G A 14: 121,627,379 H736Y probably damaging Het
Dpp3 A T 19: 4,921,167 V214E probably damaging Het
Ect2 A T 3: 27,102,488 Y774* probably null Het
Enpep G T 3: 129,280,950 P717H probably damaging Het
Erich3 A T 3: 154,763,677 probably benign Het
Fbp2 C T 13: 62,858,177 A41T probably damaging Het
Fbxl21 T C 13: 56,527,061 V75A probably damaging Het
Fkbp5 C T 17: 28,415,945 D197N probably benign Het
Fsip2 A G 2: 82,976,954 T1206A probably benign Het
Ggt7 A G 2: 155,503,460 V156A probably benign Het
Gm15448 T A 7: 3,822,164 Y493F possibly damaging Het
Gpi1 T C 7: 34,202,520 K156R probably damaging Het
Gpx5 T C 13: 21,287,499 D178G probably damaging Het
Grm7 G A 6: 111,207,805 E366K probably damaging Het
Haao T C 17: 83,831,674 Q277R probably damaging Het
Lama1 T C 17: 67,753,758 S694P Het
Lrp10 A G 14: 54,468,493 D380G probably benign Het
Lrp2 C A 2: 69,472,455 D2977Y probably damaging Het
Map2 T A 1: 66,414,906 M985K probably benign Het
Met C A 6: 17,535,928 N784K possibly damaging Het
Met T A 6: 17,535,929 Y65N probably damaging Het
Muc6 T G 7: 141,639,979 probably benign Het
Numbl T A 7: 27,280,840 W416R probably damaging Het
Nup160 G A 2: 90,707,020 S746N probably benign Het
Pcca G A 14: 122,650,288 G102D probably damaging Het
Psmc2 T A 5: 21,801,219 F243L possibly damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rpn1 G T 6: 88,099,303 V357L probably benign Het
Rtn3 A G 19: 7,456,491 F712S possibly damaging Het
Scgb1b10 T A 7: 32,101,149 D54E probably benign Het
Scn5a A G 9: 119,486,329 I1771T probably damaging Het
Sec14l1 A G 11: 117,156,394 I633V probably damaging Het
Slc17a6 T C 7: 51,661,476 Y313H possibly damaging Het
Slc18a1 G A 8: 69,038,862 T500I probably benign Het
Slx4 G A 16: 3,995,838 A93V probably damaging Het
Stat4 T C 1: 52,068,815 S148P probably benign Het
Tbc1d15 A T 10: 115,209,569 C497S probably damaging Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Trav3-3 C A 14: 53,666,345 P40Q possibly damaging Het
Trpv6 A T 6: 41,625,456 L332Q probably damaging Het
Ube2t T G 1: 134,969,295 V55G probably damaging Het
Ufm1 T C 3: 53,857,981 K69E probably damaging Het
Utp20 T C 10: 88,778,240 D1284G probably benign Het
Vil1 C T 1: 74,423,954 T432I probably damaging Het
Vps13b T A 15: 35,448,581 I567K probably benign Het
Zfp236 A T 18: 82,628,363 V1023D probably damaging Het
Zfp429 A G 13: 67,389,961 Y455H probably benign Het
Other mutations in Dtx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02131:Dtx3 APN 10 127193279 missense probably damaging 0.99
IGL02314:Dtx3 APN 10 127190959 unclassified probably benign
R0257:Dtx3 UTSW 10 127192892 missense probably benign
R1108:Dtx3 UTSW 10 127191289 missense possibly damaging 0.84
R1422:Dtx3 UTSW 10 127191289 missense possibly damaging 0.84
R3693:Dtx3 UTSW 10 127191424 missense probably benign 0.33
R4016:Dtx3 UTSW 10 127191171 missense probably benign 0.00
R4231:Dtx3 UTSW 10 127193189 missense possibly damaging 0.92
R4232:Dtx3 UTSW 10 127193189 missense possibly damaging 0.92
R4236:Dtx3 UTSW 10 127193189 missense possibly damaging 0.92
R4590:Dtx3 UTSW 10 127192695 missense probably damaging 0.99
R4838:Dtx3 UTSW 10 127191307 unclassified probably null
R5338:Dtx3 UTSW 10 127193050 missense probably benign 0.23
R5510:Dtx3 UTSW 10 127192938 missense probably benign 0.08
R7225:Dtx3 UTSW 10 127191489 missense probably damaging 0.99
R8137:Dtx3 UTSW 10 127193172 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- ATCCTTGGAGACCAGCATCC -3'
(R):5'- CTCTCAAGGGGCTACTGAAAGAG -3'

Sequencing Primer
(F):5'- AGACCAGCATCCGTCCGTTC -3'
(R):5'- GAGCTCATGGGCTGCCTG -3'
Posted On2018-11-28