Incidental Mutation 'R6989:Rictor'
ID543166
Institutional Source Beutler Lab
Gene Symbol Rictor
Ensembl Gene ENSMUSG00000050310
Gene NameRPTOR independent companion of MTOR, complex 2
SynonymsD530039E11Rik, 4921505C17Rik, 6030405M08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6989 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location6708379-6800401 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 6772154 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 441 (S441L)
Ref Sequence ENSEMBL: ENSMUSP00000051809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061656]
Predicted Effect probably benign
Transcript: ENSMUST00000061656
AA Change: S441L

PolyPhen 2 Score 0.272 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000051809
Gene: ENSMUSG00000050310
AA Change: S441L

DomainStartEndE-ValueType
RICTOR_N 57 439 4.02e-185 SMART
RICTOR_M 523 742 5.66e-98 SMART
RasGEF_N_2 743 857 1.26e-54 SMART
RICTOR_V 920 992 1.44e-40 SMART
low complexity region 1019 1043 N/A INTRINSIC
RICTOR_phospho 1084 1189 4.06e-58 SMART
low complexity region 1221 1239 N/A INTRINSIC
low complexity region 1255 1266 N/A INTRINSIC
low complexity region 1273 1287 N/A INTRINSIC
low complexity region 1404 1414 N/A INTRINSIC
low complexity region 1464 1474 N/A INTRINSIC
low complexity region 1616 1628 N/A INTRINSIC
Meta Mutation Damage Score 0.1015 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RICTOR and MTOR (FRAP1; MIM 601231) are components of a protein complex that integrates nutrient- and growth factor-derived signals to regulate cell growth (Sarbassov et al., 2004 [PubMed 15268862]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during organogenesis associated with abnormal placental morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921536K21Rik C T 11: 3,890,076 R107H probably damaging Het
4930438A08Rik T C 11: 58,287,402 V96A possibly damaging Het
Abcc2 A G 19: 43,832,172 D1370G probably damaging Het
Abcc9 T A 6: 142,688,981 N186Y probably damaging Het
Adcy7 T C 8: 88,308,786 V106A probably benign Het
Adgra3 A G 5: 50,006,884 F251S probably damaging Het
Akr1c6 T A 13: 4,449,046 I33N probably damaging Het
Alk A C 17: 71,897,952 M1075R probably benign Het
Amh A G 10: 80,805,504 Q86R probably benign Het
Aox1 T C 1: 58,085,452 Y951H probably damaging Het
Arhgap26 G T 18: 39,099,629 R119L probably damaging Het
Arl8a A G 1: 135,146,997 K7R probably benign Het
Birc6 T G 17: 74,630,989 S2638A probably benign Het
Ccdc162 T G 10: 41,581,353 Q256H probably damaging Het
Cenpe T A 3: 135,235,127 L679Q probably damaging Het
Cpa5 T A 6: 30,625,892 H203Q probably benign Het
Cpne9 A T 6: 113,300,583 D421V possibly damaging Het
Cux1 A T 5: 136,279,648 C1212* probably null Het
Dock9 G A 14: 121,627,379 H736Y probably damaging Het
Dpp3 A T 19: 4,921,167 V214E probably damaging Het
Dtx3 T C 10: 127,192,877 E161G probably benign Het
Ect2 A T 3: 27,102,488 Y774* probably null Het
Enpep G T 3: 129,280,950 P717H probably damaging Het
Erich3 A T 3: 154,763,677 probably benign Het
Fbp2 C T 13: 62,858,177 A41T probably damaging Het
Fbxl21 T C 13: 56,527,061 V75A probably damaging Het
Fkbp5 C T 17: 28,415,945 D197N probably benign Het
Fsip2 A G 2: 82,976,954 T1206A probably benign Het
Ggt7 A G 2: 155,503,460 V156A probably benign Het
Gm15448 T A 7: 3,822,164 Y493F possibly damaging Het
Gpi1 T C 7: 34,202,520 K156R probably damaging Het
Gpx5 T C 13: 21,287,499 D178G probably damaging Het
Grm7 G A 6: 111,207,805 E366K probably damaging Het
Haao T C 17: 83,831,674 Q277R probably damaging Het
Lama1 T C 17: 67,753,758 S694P Het
Lrp10 A G 14: 54,468,493 D380G probably benign Het
Lrp2 C A 2: 69,472,455 D2977Y probably damaging Het
Map2 T A 1: 66,414,906 M985K probably benign Het
Met C A 6: 17,535,928 N784K possibly damaging Het
Met T A 6: 17,535,929 Y65N probably damaging Het
Muc6 T G 7: 141,639,979 probably benign Het
Numbl T A 7: 27,280,840 W416R probably damaging Het
Nup160 G A 2: 90,707,020 S746N probably benign Het
Pcca G A 14: 122,650,288 G102D probably damaging Het
Psmc2 T A 5: 21,801,219 F243L possibly damaging Het
Rpn1 G T 6: 88,099,303 V357L probably benign Het
Rtn3 A G 19: 7,456,491 F712S possibly damaging Het
Scgb1b10 T A 7: 32,101,149 D54E probably benign Het
Scn5a A G 9: 119,486,329 I1771T probably damaging Het
Sec14l1 A G 11: 117,156,394 I633V probably damaging Het
Slc17a6 T C 7: 51,661,476 Y313H possibly damaging Het
Slc18a1 G A 8: 69,038,862 T500I probably benign Het
Slx4 G A 16: 3,995,838 A93V probably damaging Het
Stat4 T C 1: 52,068,815 S148P probably benign Het
Tbc1d15 A T 10: 115,209,569 C497S probably damaging Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Trav3-3 C A 14: 53,666,345 P40Q possibly damaging Het
Trpv6 A T 6: 41,625,456 L332Q probably damaging Het
Ube2t T G 1: 134,969,295 V55G probably damaging Het
Ufm1 T C 3: 53,857,981 K69E probably damaging Het
Utp20 T C 10: 88,778,240 D1284G probably benign Het
Vil1 C T 1: 74,423,954 T432I probably damaging Het
Vps13b T A 15: 35,448,581 I567K probably benign Het
Zfp236 A T 18: 82,628,363 V1023D probably damaging Het
Zfp429 A G 13: 67,389,961 Y455H probably benign Het
Other mutations in Rictor
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Rictor APN 15 6786590 missense probably damaging 0.99
IGL00785:Rictor APN 15 6776950 missense probably damaging 1.00
IGL00801:Rictor APN 15 6794534 missense probably damaging 1.00
IGL01072:Rictor APN 15 6789562 missense probably damaging 0.98
IGL01139:Rictor APN 15 6778268 missense probably damaging 1.00
IGL01303:Rictor APN 15 6708638 missense probably benign 0.10
IGL01307:Rictor APN 15 6774604 splice site probably null
IGL01767:Rictor APN 15 6777384 missense probably damaging 1.00
IGL01774:Rictor APN 15 6769777 missense probably damaging 1.00
IGL01800:Rictor APN 15 6774701 missense probably damaging 0.99
IGL02192:Rictor APN 15 6786414 missense probably benign 0.00
IGL02503:Rictor APN 15 6786443 missense probably benign 0.06
IGL02652:Rictor APN 15 6776187 critical splice donor site probably null
IGL02656:Rictor APN 15 6776920 missense probably damaging 0.98
IGL02752:Rictor APN 15 6787371 missense probably benign 0.02
IGL03000:Rictor APN 15 6769240 splice site probably benign
IGL03118:Rictor APN 15 6759518 missense possibly damaging 0.93
IGL03182:Rictor APN 15 6789598 missense probably benign 0.08
Tense UTSW 15 6759496 missense possibly damaging 0.94
Tonus UTSW 15 6769334 critical splice donor site probably null
Torrid UTSW 15 6759572 missense probably damaging 1.00
R0149:Rictor UTSW 15 6784107 missense possibly damaging 0.76
R0288:Rictor UTSW 15 6786540 missense probably benign 0.08
R0304:Rictor UTSW 15 6786371 splice site probably null
R0336:Rictor UTSW 15 6776753 critical splice acceptor site probably null
R0361:Rictor UTSW 15 6784107 missense possibly damaging 0.76
R0423:Rictor UTSW 15 6773900 missense possibly damaging 0.77
R0453:Rictor UTSW 15 6708642 missense probably benign 0.01
R0515:Rictor UTSW 15 6769301 missense probably damaging 1.00
R0630:Rictor UTSW 15 6794492 missense probably damaging 1.00
R0730:Rictor UTSW 15 6773986 splice site probably benign
R0744:Rictor UTSW 15 6764278 critical splice acceptor site probably null
R0836:Rictor UTSW 15 6764278 critical splice acceptor site probably null
R0881:Rictor UTSW 15 6791670 missense probably benign
R1114:Rictor UTSW 15 6794005 nonsense probably null
R1367:Rictor UTSW 15 6790638 splice site probably benign
R1655:Rictor UTSW 15 6772212 missense probably benign 0.00
R1678:Rictor UTSW 15 6756471 missense probably benign 0.07
R1679:Rictor UTSW 15 6768090 missense possibly damaging 0.92
R1754:Rictor UTSW 15 6735368 missense probably damaging 1.00
R1757:Rictor UTSW 15 6773862 missense possibly damaging 0.95
R1762:Rictor UTSW 15 6756573 missense probably benign 0.00
R1914:Rictor UTSW 15 6759572 missense probably damaging 1.00
R1915:Rictor UTSW 15 6759572 missense probably damaging 1.00
R1994:Rictor UTSW 15 6776156 missense probably benign 0.18
R2145:Rictor UTSW 15 6765107 missense probably damaging 1.00
R2182:Rictor UTSW 15 6772204 missense probably damaging 0.96
R2191:Rictor UTSW 15 6759614 missense probably benign 0.04
R2357:Rictor UTSW 15 6783562 missense probably damaging 0.99
R2914:Rictor UTSW 15 6769995 critical splice donor site probably null
R3082:Rictor UTSW 15 6774857 missense probably benign 0.15
R3885:Rictor UTSW 15 6759610 missense probably damaging 1.00
R3900:Rictor UTSW 15 6789473 missense probably benign 0.01
R4376:Rictor UTSW 15 6786967 missense probably benign 0.00
R4611:Rictor UTSW 15 6787144 missense possibly damaging 0.75
R4644:Rictor UTSW 15 6777935 nonsense probably null
R4718:Rictor UTSW 15 6783160 missense possibly damaging 0.81
R4822:Rictor UTSW 15 6791680 missense probably benign 0.01
R4980:Rictor UTSW 15 6781660 missense probably damaging 1.00
R5034:Rictor UTSW 15 6768095 missense probably damaging 0.98
R5179:Rictor UTSW 15 6795940 missense probably damaging 1.00
R5386:Rictor UTSW 15 6789504 missense probably benign 0.37
R5532:Rictor UTSW 15 6789565 missense probably damaging 1.00
R5549:Rictor UTSW 15 6786910 missense probably damaging 1.00
R5715:Rictor UTSW 15 6750716 nonsense probably null
R5733:Rictor UTSW 15 6783104 missense probably benign
R5822:Rictor UTSW 15 6794006 missense probably benign 0.00
R5848:Rictor UTSW 15 6794006 missense probably benign 0.00
R5849:Rictor UTSW 15 6794006 missense probably benign 0.00
R5850:Rictor UTSW 15 6794006 missense probably benign 0.00
R5854:Rictor UTSW 15 6794006 missense probably benign 0.00
R5855:Rictor UTSW 15 6794006 missense probably benign 0.00
R5856:Rictor UTSW 15 6794006 missense probably benign 0.00
R5936:Rictor UTSW 15 6784161 missense probably damaging 0.99
R6155:Rictor UTSW 15 6793977 missense probably benign 0.44
R6394:Rictor UTSW 15 6769309 missense possibly damaging 0.59
R6549:Rictor UTSW 15 6796175 missense probably damaging 1.00
R6611:Rictor UTSW 15 6750659 missense probably damaging 1.00
R6657:Rictor UTSW 15 6759496 missense possibly damaging 0.94
R6705:Rictor UTSW 15 6794012 missense probably benign 0.00
R6819:Rictor UTSW 15 6796036 critical splice donor site probably null
R6985:Rictor UTSW 15 6772154 missense probably benign 0.27
R7016:Rictor UTSW 15 6774880 critical splice donor site probably null
R7030:Rictor UTSW 15 6708453 critical splice donor site probably null
R7066:Rictor UTSW 15 6772154 missense probably benign 0.27
R7067:Rictor UTSW 15 6772154 missense probably benign 0.27
R7216:Rictor UTSW 15 6769301 missense probably damaging 1.00
R7396:Rictor UTSW 15 6786981 missense not run
R7449:Rictor UTSW 15 6772154 missense probably benign 0.27
R7450:Rictor UTSW 15 6772154 missense probably benign 0.27
R7452:Rictor UTSW 15 6772154 missense probably benign 0.27
R7616:Rictor UTSW 15 6772154 missense probably benign 0.27
R7620:Rictor UTSW 15 6772154 missense probably benign 0.27
R7643:Rictor UTSW 15 6769269 nonsense probably null
R7699:Rictor UTSW 15 6772154 missense probably benign 0.27
R7700:Rictor UTSW 15 6772154 missense probably benign 0.27
R7749:Rictor UTSW 15 6772154 missense probably benign 0.27
R7750:Rictor UTSW 15 6772154 missense probably benign 0.27
R7751:Rictor UTSW 15 6772154 missense probably benign 0.27
R7753:Rictor UTSW 15 6772154 missense probably benign 0.27
R7841:Rictor UTSW 15 6772154 missense probably benign 0.27
R7894:Rictor UTSW 15 6772154 missense probably benign 0.27
R7897:Rictor UTSW 15 6772154 missense probably benign 0.27
R7898:Rictor UTSW 15 6772154 missense probably benign 0.27
R7937:Rictor UTSW 15 6772154 missense probably benign 0.27
R7944:Rictor UTSW 15 6772154 missense probably benign 0.27
R8062:Rictor UTSW 15 6772154 missense probably benign 0.27
R8063:Rictor UTSW 15 6772154 missense probably benign 0.27
R8094:Rictor UTSW 15 6772154 missense probably benign 0.27
R8119:Rictor UTSW 15 6772154 missense probably benign 0.27
R8134:Rictor UTSW 15 6772154 missense probably benign 0.27
R8166:Rictor UTSW 15 6769334 critical splice donor site probably null
R8324:Rictor UTSW 15 6745562 missense probably damaging 1.00
R8343:Rictor UTSW 15 6778319 critical splice donor site probably null
R8691:Rictor UTSW 15 6787032 missense probably damaging 1.00
R8859:Rictor UTSW 15 6783586 missense probably damaging 0.98
R8953:Rictor UTSW 15 6794447 missense probably benign 0.39
X0020:Rictor UTSW 15 6756482 missense probably benign 0.32
X0060:Rictor UTSW 15 6786552 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GATTGGCAACTTTTAGAAGCCA -3'
(R):5'- AGAATTGTAACTTCCCCTTCTTGG -3'

Sequencing Primer
(F):5'- CCATGTAGATCCTGGGATAGAACTC -3'
(R):5'- ACACAACCTATCAACTCCTTGTTTTC -3'
Posted On2018-11-28