Incidental Mutation 'R6989:Haao'
ID543174
Institutional Source Beutler Lab
Gene Symbol Haao
Ensembl Gene ENSMUSG00000000673
Gene Name3-hydroxyanthranilate 3,4-dioxygenase
Synonyms3HAO, 0610012J07Rik, 0610007K21Rik, 3-HAO, 3-HAOxase
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6989 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location83831356-83846790 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83831674 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 277 (Q277R)
Ref Sequence ENSEMBL: ENSMUSP00000000687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000687]
Predicted Effect probably damaging
Transcript: ENSMUST00000000687
AA Change: Q277R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000687
Gene: ENSMUSG00000000673
AA Change: Q277R

DomainStartEndE-ValueType
Pfam:3-HAO 1 149 1e-78 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] 3-Hydroxyanthranilate 3,4-dioxygenase is a monomeric cytosolic protein belonging to the family of intramolecular dioxygenases containing nonheme ferrous iron. It is widely distributed in peripheral organs, such as liver and kidney, and is also present in low amounts in the central nervous system. HAAO catalyzes the synthesis of quinolinic acid (QUIN) from 3-hydroxyanthranilic acid. QUIN is an excitotoxin whose toxicity is mediated by its ability to activate glutamate N-methyl-D-aspartate receptors. Increased cerebral levels of QUIN may participate in the pathogenesis of neurologic and inflammatory disorders. HAAO has been suggested to play a role in disorders associated with altered tissue levels of QUIN. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced LPS-induced depressive behaviors and altered kynurenine metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921536K21Rik C T 11: 3,890,076 R107H probably damaging Het
4930438A08Rik T C 11: 58,287,402 V96A possibly damaging Het
Abcc2 A G 19: 43,832,172 D1370G probably damaging Het
Abcc9 T A 6: 142,688,981 N186Y probably damaging Het
Adcy7 T C 8: 88,308,786 V106A probably benign Het
Adgra3 A G 5: 50,006,884 F251S probably damaging Het
Akr1c6 T A 13: 4,449,046 I33N probably damaging Het
Alk A C 17: 71,897,952 M1075R probably benign Het
Amh A G 10: 80,805,504 Q86R probably benign Het
Aox1 T C 1: 58,085,452 Y951H probably damaging Het
Arhgap26 G T 18: 39,099,629 R119L probably damaging Het
Arl8a A G 1: 135,146,997 K7R probably benign Het
Birc6 T G 17: 74,630,989 S2638A probably benign Het
Ccdc162 T G 10: 41,581,353 Q256H probably damaging Het
Cenpe T A 3: 135,235,127 L679Q probably damaging Het
Cpa5 T A 6: 30,625,892 H203Q probably benign Het
Cpne9 A T 6: 113,300,583 D421V possibly damaging Het
Cux1 A T 5: 136,279,648 C1212* probably null Het
Dock9 G A 14: 121,627,379 H736Y probably damaging Het
Dpp3 A T 19: 4,921,167 V214E probably damaging Het
Dtx3 T C 10: 127,192,877 E161G probably benign Het
Ect2 A T 3: 27,102,488 Y774* probably null Het
Enpep G T 3: 129,280,950 P717H probably damaging Het
Erich3 A T 3: 154,763,677 probably benign Het
Fbp2 C T 13: 62,858,177 A41T probably damaging Het
Fbxl21 T C 13: 56,527,061 V75A probably damaging Het
Fkbp5 C T 17: 28,415,945 D197N probably benign Het
Fsip2 A G 2: 82,976,954 T1206A probably benign Het
Ggt7 A G 2: 155,503,460 V156A probably benign Het
Gm15448 T A 7: 3,822,164 Y493F possibly damaging Het
Gpi1 T C 7: 34,202,520 K156R probably damaging Het
Gpx5 T C 13: 21,287,499 D178G probably damaging Het
Grm7 G A 6: 111,207,805 E366K probably damaging Het
Lama1 T C 17: 67,753,758 S694P Het
Lrp10 A G 14: 54,468,493 D380G probably benign Het
Lrp2 C A 2: 69,472,455 D2977Y probably damaging Het
Map2 T A 1: 66,414,906 M985K probably benign Het
Met C A 6: 17,535,928 N784K possibly damaging Het
Met T A 6: 17,535,929 Y65N probably damaging Het
Muc6 T G 7: 141,639,979 probably benign Het
Numbl T A 7: 27,280,840 W416R probably damaging Het
Nup160 G A 2: 90,707,020 S746N probably benign Het
Pcca G A 14: 122,650,288 G102D probably damaging Het
Psmc2 T A 5: 21,801,219 F243L possibly damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rpn1 G T 6: 88,099,303 V357L probably benign Het
Rtn3 A G 19: 7,456,491 F712S possibly damaging Het
Scgb1b10 T A 7: 32,101,149 D54E probably benign Het
Scn5a A G 9: 119,486,329 I1771T probably damaging Het
Sec14l1 A G 11: 117,156,394 I633V probably damaging Het
Slc17a6 T C 7: 51,661,476 Y313H possibly damaging Het
Slc18a1 G A 8: 69,038,862 T500I probably benign Het
Slx4 G A 16: 3,995,838 A93V probably damaging Het
Stat4 T C 1: 52,068,815 S148P probably benign Het
Tbc1d15 A T 10: 115,209,569 C497S probably damaging Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Trav3-3 C A 14: 53,666,345 P40Q possibly damaging Het
Trpv6 A T 6: 41,625,456 L332Q probably damaging Het
Ube2t T G 1: 134,969,295 V55G probably damaging Het
Ufm1 T C 3: 53,857,981 K69E probably damaging Het
Utp20 T C 10: 88,778,240 D1284G probably benign Het
Vil1 C T 1: 74,423,954 T432I probably damaging Het
Vps13b T A 15: 35,448,581 I567K probably benign Het
Zfp236 A T 18: 82,628,363 V1023D probably damaging Het
Zfp429 A G 13: 67,389,961 Y455H probably benign Het
Other mutations in Haao
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Haao APN 17 83834930 splice site probably benign
IGL01728:Haao APN 17 83835229 missense probably damaging 1.00
IGL02603:Haao APN 17 83835541 missense probably benign 0.45
IGL03328:Haao APN 17 83846649 missense probably damaging 1.00
R0635:Haao UTSW 17 83838574 missense probably damaging 1.00
R1295:Haao UTSW 17 83838838 missense probably benign 0.38
R1296:Haao UTSW 17 83838838 missense probably benign 0.38
R1472:Haao UTSW 17 83838838 missense probably benign 0.38
R1563:Haao UTSW 17 83834889 missense probably benign 0.01
R2424:Haao UTSW 17 83835562 missense probably damaging 0.99
R3917:Haao UTSW 17 83838799 critical splice donor site probably null
R4657:Haao UTSW 17 83832345 missense possibly damaging 0.67
R4857:Haao UTSW 17 83838580 critical splice acceptor site probably null
R6475:Haao UTSW 17 83831684 missense possibly damaging 0.87
R7390:Haao UTSW 17 83846652 missense probably damaging 0.99
R8073:Haao UTSW 17 83835220 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TGCCAGTGACAGCTCTCAAC -3'
(R):5'- CCTCTAAGGTGACAATGGGAGG -3'

Sequencing Primer
(F):5'- GCTCTCAACCACTCAAGGGG -3'
(R):5'- TATAGCCCTGGCCCCAGATG -3'
Posted On2018-11-28