Incidental Mutation 'R6990:Tmem63a'
ID543180
Institutional Source Beutler Lab
Gene Symbol Tmem63a
Ensembl Gene ENSMUSG00000026519
Gene Nametransmembrane protein 63a
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R6990 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location180942344-180975112 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 180961121 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 341 (V341A)
Ref Sequence ENSEMBL: ENSMUSP00000124021 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027800] [ENSMUST00000161523]
Predicted Effect probably benign
Transcript: ENSMUST00000027800
AA Change: V341A

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000027800
Gene: ENSMUSG00000026519
AA Change: V341A

DomainStartEndE-ValueType
Pfam:RSN1_TM 50 213 3.3e-24 PFAM
Pfam:PHM7_cyt 261 327 8.2e-12 PFAM
Pfam:RSN1_7TM 349 692 1.5e-87 PFAM
transmembrane domain 697 719 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161523
AA Change: V341A

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000124021
Gene: ENSMUSG00000026519
AA Change: V341A

DomainStartEndE-ValueType
Pfam:RSN1_TM 50 213 3.6e-25 PFAM
Pfam:DUF4463 261 326 9.4e-15 PFAM
Pfam:DUF221 349 692 1.4e-87 PFAM
transmembrane domain 697 719 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T G 10: 79,067,091 T464P probably damaging Het
Abca16 A G 7: 120,527,727 I1214V probably benign Het
Arap2 A G 5: 62,676,517 F869S probably damaging Het
Astn2 G T 4: 65,992,303 H431N possibly damaging Het
Bap1 A G 14: 31,255,651 T308A probably benign Het
Bcr G A 10: 75,131,036 E492K possibly damaging Het
Camta1 A G 4: 151,145,044 F444L probably damaging Het
Chd7 A T 4: 8,844,525 T1545S probably benign Het
Dnmt1 A T 9: 20,915,814 Y877* probably null Het
Fam13b A G 18: 34,497,447 V86A possibly damaging Het
Gm11562 T A 11: 99,619,991 R128W unknown Het
Krt86 A G 15: 101,473,833 I95V probably benign Het
Mgea5 G A 19: 45,767,476 A576V probably benign Het
Mroh2b A G 15: 4,912,802 T349A possibly damaging Het
Ms4a7 A T 19: 11,333,241 L38Q probably damaging Het
Myo1h T C 5: 114,330,160 S339P probably damaging Het
Nf2 T C 11: 4,799,944 I46V probably benign Het
Nr1h4 T C 10: 89,454,930 D416G probably benign Het
Olfr1179 A G 2: 88,402,295 M213T probably benign Het
Olfr323 T C 11: 58,625,458 E196G probably damaging Het
Pde1c C G 6: 56,442,035 E87Q possibly damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Pga5 A T 19: 10,669,415 D317E probably benign Het
Pira2 T A 7: 3,841,068 K568N probably damaging Het
Ppp2cb A G 8: 33,619,133 D290G probably benign Het
Sall4 T C 2: 168,755,070 K617E probably damaging Het
Slc7a14 G A 3: 31,223,579 P626S possibly damaging Het
Speer4b A T 5: 27,497,078 L228* probably null Het
Spns2 T C 11: 72,489,621 T59A probably benign Het
Tbc1d5 A T 17: 50,968,232 N78K probably benign Het
Trpt1 A G 19: 6,998,315 T146A probably benign Het
Tyrp1 T C 4: 80,835,437 C122R probably damaging Het
Uchl1 A G 5: 66,682,475 E120G possibly damaging Het
Ucn3 C T 13: 3,941,295 R119Q possibly damaging Het
Uhrf1bp1l A G 10: 89,806,117 D1050G probably benign Het
Vmn2r2 T G 3: 64,117,187 I658L probably benign Het
Vmn2r96 T A 17: 18,583,820 V444E probably benign Het
Wdr54 A C 6: 83,155,647 probably null Het
Xcr1 A G 9: 123,856,235 L154P probably benign Het
Zbtb26 T C 2: 37,436,545 K160E probably benign Het
Zfp157 T G 5: 138,456,510 Y323* probably null Het
Zfp850 A T 7: 27,990,376 F136I probably benign Het
Other mutations in Tmem63a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Tmem63a APN 1 180963088 missense probably damaging 1.00
IGL00331:Tmem63a APN 1 180966497 missense possibly damaging 0.46
IGL01116:Tmem63a APN 1 180972089 missense probably damaging 0.96
IGL01368:Tmem63a APN 1 180970232 missense possibly damaging 0.69
IGL01445:Tmem63a APN 1 180946631 missense probably damaging 1.00
IGL01867:Tmem63a APN 1 180956005 missense possibly damaging 0.87
IGL02043:Tmem63a APN 1 180972788 missense probably benign 0.11
IGL02453:Tmem63a APN 1 180963069 missense probably benign 0.02
IGL02527:Tmem63a APN 1 180952974 splice site probably null
IGL02811:Tmem63a APN 1 180965783 missense probably damaging 0.99
IGL02975:Tmem63a APN 1 180961075 missense probably benign
IGL03304:Tmem63a APN 1 180968853 nonsense probably null
R0029:Tmem63a UTSW 1 180962466 missense probably benign 0.01
R0029:Tmem63a UTSW 1 180962466 missense probably benign 0.01
R0173:Tmem63a UTSW 1 180954798 splice site probably benign
R0358:Tmem63a UTSW 1 180956423 missense probably benign 0.17
R0436:Tmem63a UTSW 1 180972733 missense probably benign 0.03
R0506:Tmem63a UTSW 1 180958049 critical splice donor site probably null
R0513:Tmem63a UTSW 1 180960461 missense probably benign 0.00
R0529:Tmem63a UTSW 1 180961094 missense probably benign 0.09
R0855:Tmem63a UTSW 1 180961060 missense possibly damaging 0.82
R1633:Tmem63a UTSW 1 180948826 missense probably damaging 0.98
R2129:Tmem63a UTSW 1 180965540 missense probably benign 0.00
R2212:Tmem63a UTSW 1 180963114 missense possibly damaging 0.48
R2214:Tmem63a UTSW 1 180961114 missense probably benign 0.00
R2413:Tmem63a UTSW 1 180961075 missense probably benign
R2437:Tmem63a UTSW 1 180962489 splice site probably null
R3703:Tmem63a UTSW 1 180963114 missense possibly damaging 0.48
R3704:Tmem63a UTSW 1 180963114 missense possibly damaging 0.48
R3705:Tmem63a UTSW 1 180963114 missense possibly damaging 0.48
R3714:Tmem63a UTSW 1 180963114 missense possibly damaging 0.48
R3746:Tmem63a UTSW 1 180963114 missense possibly damaging 0.48
R3747:Tmem63a UTSW 1 180963114 missense possibly damaging 0.48
R3961:Tmem63a UTSW 1 180963114 missense possibly damaging 0.48
R3963:Tmem63a UTSW 1 180963114 missense possibly damaging 0.48
R4675:Tmem63a UTSW 1 180956491 missense probably benign 0.00
R4795:Tmem63a UTSW 1 180954851 missense probably damaging 1.00
R4876:Tmem63a UTSW 1 180973186 missense probably benign
R4916:Tmem63a UTSW 1 180966521 missense probably benign 0.36
R4917:Tmem63a UTSW 1 180966521 missense probably benign 0.36
R4918:Tmem63a UTSW 1 180966521 missense probably benign 0.36
R5620:Tmem63a UTSW 1 180970246 missense probably benign 0.00
R5843:Tmem63a UTSW 1 180972833 critical splice donor site probably null
R5937:Tmem63a UTSW 1 180961151 missense probably damaging 1.00
R6823:Tmem63a UTSW 1 180960470 missense possibly damaging 0.60
R7075:Tmem63a UTSW 1 180961149 missense probably damaging 1.00
R7129:Tmem63a UTSW 1 180954876 missense probably damaging 0.98
R7447:Tmem63a UTSW 1 180958023 missense probably benign 0.04
R7609:Tmem63a UTSW 1 180952974 splice site probably null
R8116:Tmem63a UTSW 1 180960483 missense probably benign 0.04
R8141:Tmem63a UTSW 1 180974211 missense probably benign 0.06
R8296:Tmem63a UTSW 1 180961120 missense probably benign 0.36
R8770:Tmem63a UTSW 1 180962396 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GTGAGACATTGCCATCTATCTGC -3'
(R):5'- CTTCCAGCTGTCACTCAGAC -3'

Sequencing Primer
(F):5'- GCCATCTATCTGCCTGGAG -3'
(R):5'- GTCACTCAGACATAAACTGGACTTC -3'
Posted On2018-11-28