Incidental Mutation 'R6990:Zbtb26'
ID543181
Institutional Source Beutler Lab
Gene Symbol Zbtb26
Ensembl Gene ENSMUSG00000050714
Gene Namezinc finger and BTB domain containing 26
SynonymsA630026F21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.265) question?
Stock #R6990 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location37432168-37443135 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37436545 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 160 (K160E)
Ref Sequence ENSEMBL: ENSMUSP00000099850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067043] [ENSMUST00000102789] [ENSMUST00000112932]
Predicted Effect probably benign
Transcript: ENSMUST00000067043
AA Change: K149E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000070071
Gene: ENSMUSG00000050714
AA Change: K149E

DomainStartEndE-ValueType
BTB 33 127 4.38e-12 SMART
low complexity region 169 179 N/A INTRINSIC
ZnF_C2H2 273 295 1.36e-2 SMART
ZnF_C2H2 298 320 1.4e-4 SMART
ZnF_C2H2 326 348 2.99e-4 SMART
ZnF_C2H2 354 377 2.09e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102789
AA Change: K160E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000099850
Gene: ENSMUSG00000050714
AA Change: K160E

DomainStartEndE-ValueType
BTB 44 138 4.38e-12 SMART
low complexity region 180 190 N/A INTRINSIC
ZnF_C2H2 284 306 1.36e-2 SMART
ZnF_C2H2 309 331 1.4e-4 SMART
ZnF_C2H2 337 359 2.99e-4 SMART
ZnF_C2H2 365 388 2.09e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112932
SMART Domains Protein: ENSMUSP00000108554
Gene: ENSMUSG00000066798

DomainStartEndE-ValueType
BTB 33 127 2.67e-16 SMART
Blast:BTB 161 196 1e-5 BLAST
ZnF_C2H2 300 322 7.15e-2 SMART
ZnF_C2H2 325 347 1.58e-3 SMART
ZnF_C2H2 353 375 3.63e-3 SMART
ZnF_C2H2 381 404 8.81e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T G 10: 79,067,091 T464P probably damaging Het
Abca16 A G 7: 120,527,727 I1214V probably benign Het
Arap2 A G 5: 62,676,517 F869S probably damaging Het
Astn2 G T 4: 65,992,303 H431N possibly damaging Het
Bap1 A G 14: 31,255,651 T308A probably benign Het
Bcr G A 10: 75,131,036 E492K possibly damaging Het
Camta1 A G 4: 151,145,044 F444L probably damaging Het
Chd7 A T 4: 8,844,525 T1545S probably benign Het
Dnmt1 A T 9: 20,915,814 Y877* probably null Het
Fam13b A G 18: 34,497,447 V86A possibly damaging Het
Gm11562 T A 11: 99,619,991 R128W unknown Het
Krt86 A G 15: 101,473,833 I95V probably benign Het
Mgea5 G A 19: 45,767,476 A576V probably benign Het
Mroh2b A G 15: 4,912,802 T349A possibly damaging Het
Ms4a7 A T 19: 11,333,241 L38Q probably damaging Het
Myo1h T C 5: 114,330,160 S339P probably damaging Het
Nf2 T C 11: 4,799,944 I46V probably benign Het
Nr1h4 T C 10: 89,454,930 D416G probably benign Het
Olfr1179 A G 2: 88,402,295 M213T probably benign Het
Olfr323 T C 11: 58,625,458 E196G probably damaging Het
Pde1c C G 6: 56,442,035 E87Q possibly damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Pga5 A T 19: 10,669,415 D317E probably benign Het
Pira2 T A 7: 3,841,068 K568N probably damaging Het
Ppp2cb A G 8: 33,619,133 D290G probably benign Het
Sall4 T C 2: 168,755,070 K617E probably damaging Het
Slc7a14 G A 3: 31,223,579 P626S possibly damaging Het
Speer4b A T 5: 27,497,078 L228* probably null Het
Spns2 T C 11: 72,489,621 T59A probably benign Het
Tbc1d5 A T 17: 50,968,232 N78K probably benign Het
Tmem63a T C 1: 180,961,121 V341A probably benign Het
Trpt1 A G 19: 6,998,315 T146A probably benign Het
Tyrp1 T C 4: 80,835,437 C122R probably damaging Het
Uchl1 A G 5: 66,682,475 E120G possibly damaging Het
Ucn3 C T 13: 3,941,295 R119Q possibly damaging Het
Uhrf1bp1l A G 10: 89,806,117 D1050G probably benign Het
Vmn2r2 T G 3: 64,117,187 I658L probably benign Het
Vmn2r96 T A 17: 18,583,820 V444E probably benign Het
Wdr54 A C 6: 83,155,647 probably null Het
Xcr1 A G 9: 123,856,235 L154P probably benign Het
Zfp157 T G 5: 138,456,510 Y323* probably null Het
Zfp850 A T 7: 27,990,376 F136I probably benign Het
Other mutations in Zbtb26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Zbtb26 APN 2 37436442 missense possibly damaging 0.82
IGL00899:Zbtb26 APN 2 37436258 nonsense probably null
IGL01598:Zbtb26 APN 2 37436271 missense probably damaging 1.00
IGL01940:Zbtb26 APN 2 37435975 missense possibly damaging 0.93
IGL02152:Zbtb26 APN 2 37436691 missense possibly damaging 0.95
IGL02867:Zbtb26 APN 2 37436249 missense probably benign 0.00
IGL02889:Zbtb26 APN 2 37436249 missense probably benign 0.00
IGL03081:Zbtb26 APN 2 37436600 missense possibly damaging 0.67
R0138:Zbtb26 UTSW 2 37436041 missense probably benign 0.16
R0328:Zbtb26 UTSW 2 37436795 missense possibly damaging 0.81
R0927:Zbtb26 UTSW 2 37436325 missense possibly damaging 0.91
R1671:Zbtb26 UTSW 2 37436365 missense probably benign 0.00
R1813:Zbtb26 UTSW 2 37436335 missense possibly damaging 0.68
R1896:Zbtb26 UTSW 2 37436335 missense possibly damaging 0.68
R2128:Zbtb26 UTSW 2 37436551 missense probably benign 0.00
R2374:Zbtb26 UTSW 2 37436485 missense probably benign
R4050:Zbtb26 UTSW 2 37436988 start codon destroyed probably null 0.46
R4631:Zbtb26 UTSW 2 37436956 missense probably benign 0.00
R4940:Zbtb26 UTSW 2 37436769 missense probably damaging 0.98
R5071:Zbtb26 UTSW 2 37435929 missense probably benign 0.26
R6348:Zbtb26 UTSW 2 37435675 missense probably benign 0.43
R6962:Zbtb26 UTSW 2 37436094 missense possibly damaging 0.71
R7261:Zbtb26 UTSW 2 37436655 missense possibly damaging 0.71
R7981:Zbtb26 UTSW 2 37436875 missense possibly damaging 0.51
R8013:Zbtb26 UTSW 2 37437001 critical splice acceptor site probably null
R8014:Zbtb26 UTSW 2 37437001 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GTGCAAAGCAGTGGGTTCAG -3'
(R):5'- AGTGGGGAGACAATTGCTC -3'

Sequencing Primer
(F):5'- GGTTCAGAAGAAATGTACTGGTTCTC -3'
(R):5'- GACAATTGCTCTTGTCCTGTTATAG -3'
Posted On2018-11-28