Incidental Mutation 'R6990:Olfr1179'
ID543182
Institutional Source Beutler Lab
Gene Symbol Olfr1179
Ensembl Gene ENSMUSG00000075127
Gene Nameolfactory receptor 1179
SynonymsMOR225-2, GA_x6K02T2Q125-49890854-49889931
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R6990 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location88401859-88406453 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88402295 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 213 (M213T)
Ref Sequence ENSEMBL: ENSMUSP00000151174 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099825] [ENSMUST00000213157] [ENSMUST00000214040]
Predicted Effect probably benign
Transcript: ENSMUST00000099825
AA Change: M213T

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000097413
Gene: ENSMUSG00000075127
AA Change: M213T

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 1.1e-47 PFAM
Pfam:7tm_1 39 285 3e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213157
AA Change: M213T

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000214040
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T G 10: 79,067,091 T464P probably damaging Het
Abca16 A G 7: 120,527,727 I1214V probably benign Het
Arap2 A G 5: 62,676,517 F869S probably damaging Het
Astn2 G T 4: 65,992,303 H431N possibly damaging Het
Bap1 A G 14: 31,255,651 T308A probably benign Het
Bcr G A 10: 75,131,036 E492K possibly damaging Het
Camta1 A G 4: 151,145,044 F444L probably damaging Het
Chd7 A T 4: 8,844,525 T1545S probably benign Het
Dnmt1 A T 9: 20,915,814 Y877* probably null Het
Fam13b A G 18: 34,497,447 V86A possibly damaging Het
Gm11562 T A 11: 99,619,991 R128W unknown Het
Krt86 A G 15: 101,473,833 I95V probably benign Het
Mgea5 G A 19: 45,767,476 A576V probably benign Het
Mroh2b A G 15: 4,912,802 T349A possibly damaging Het
Ms4a7 A T 19: 11,333,241 L38Q probably damaging Het
Myo1h T C 5: 114,330,160 S339P probably damaging Het
Nf2 T C 11: 4,799,944 I46V probably benign Het
Nr1h4 T C 10: 89,454,930 D416G probably benign Het
Olfr323 T C 11: 58,625,458 E196G probably damaging Het
Pde1c C G 6: 56,442,035 E87Q possibly damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Pga5 A T 19: 10,669,415 D317E probably benign Het
Pira2 T A 7: 3,841,068 K568N probably damaging Het
Ppp2cb A G 8: 33,619,133 D290G probably benign Het
Sall4 T C 2: 168,755,070 K617E probably damaging Het
Slc7a14 G A 3: 31,223,579 P626S possibly damaging Het
Speer4b A T 5: 27,497,078 L228* probably null Het
Spns2 T C 11: 72,489,621 T59A probably benign Het
Tbc1d5 A T 17: 50,968,232 N78K probably benign Het
Tmem63a T C 1: 180,961,121 V341A probably benign Het
Trpt1 A G 19: 6,998,315 T146A probably benign Het
Tyrp1 T C 4: 80,835,437 C122R probably damaging Het
Uchl1 A G 5: 66,682,475 E120G possibly damaging Het
Ucn3 C T 13: 3,941,295 R119Q possibly damaging Het
Uhrf1bp1l A G 10: 89,806,117 D1050G probably benign Het
Vmn2r2 T G 3: 64,117,187 I658L probably benign Het
Vmn2r96 T A 17: 18,583,820 V444E probably benign Het
Wdr54 A C 6: 83,155,647 probably null Het
Xcr1 A G 9: 123,856,235 L154P probably benign Het
Zbtb26 T C 2: 37,436,545 K160E probably benign Het
Zfp157 T G 5: 138,456,510 Y323* probably null Het
Zfp850 A T 7: 27,990,376 F136I probably benign Het
Other mutations in Olfr1179
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02008:Olfr1179 APN 2 88402077 missense possibly damaging 0.95
IGL02445:Olfr1179 APN 2 88402112 missense possibly damaging 0.60
R0127:Olfr1179 UTSW 2 88402355 missense probably benign 0.05
R0604:Olfr1179 UTSW 2 88402383 missense probably benign 0.03
R1526:Olfr1179 UTSW 2 88402433 missense probably damaging 1.00
R1816:Olfr1179 UTSW 2 88402599 missense possibly damaging 0.65
R2041:Olfr1179 UTSW 2 88402224 missense probably damaging 1.00
R3694:Olfr1179 UTSW 2 88402196 missense possibly damaging 0.80
R4229:Olfr1179 UTSW 2 88402883 missense possibly damaging 0.67
R4735:Olfr1179 UTSW 2 88402923 missense probably benign 0.02
R4974:Olfr1179 UTSW 2 88402412 missense probably damaging 1.00
R5173:Olfr1179 UTSW 2 88402922 missense probably benign 0.00
R5909:Olfr1179 UTSW 2 88402191 missense probably damaging 0.98
R6931:Olfr1179 UTSW 2 88402064 missense probably benign 0.01
R7167:Olfr1179 UTSW 2 88402208 missense possibly damaging 0.46
R8121:Olfr1179 UTSW 2 88402696 missense probably benign
R8140:Olfr1179 UTSW 2 88402113 missense possibly damaging 0.74
R8269:Olfr1179 UTSW 2 88402037 missense probably damaging 0.98
Z1176:Olfr1179 UTSW 2 88402122 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTTTCTCAGAGTGTAGATCAGAG -3'
(R):5'- AGAGCCTCCTTGCTATCAGC -3'

Sequencing Primer
(F):5'- CTCAGAGTGTAGATCAGAGGGTTG -3'
(R):5'- ATCAGCCTCCCCTTCTGTGG -3'
Posted On2018-11-28