Incidental Mutation 'R6990:Sall4'
ID543183
Institutional Source Beutler Lab
Gene Symbol Sall4
Ensembl Gene ENSMUSG00000027547
Gene Namespalt like transcription factor 4
Synonyms5730441M18Rik, Tex20, C330011P20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6990 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location168748332-168767943 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 168755070 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 617 (K617E)
Ref Sequence ENSEMBL: ENSMUSP00000029061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029061] [ENSMUST00000075044] [ENSMUST00000103074] [ENSMUST00000137536] [ENSMUST00000150588]
Predicted Effect probably damaging
Transcript: ENSMUST00000029061
AA Change: K617E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029061
Gene: ENSMUSG00000027547
AA Change: K617E

DomainStartEndE-ValueType
low complexity region 15 24 N/A INTRINSIC
low complexity region 25 42 N/A INTRINSIC
ZnF_C2H2 68 88 1.31e2 SMART
low complexity region 193 203 N/A INTRINSIC
low complexity region 210 230 N/A INTRINSIC
low complexity region 254 278 N/A INTRINSIC
low complexity region 295 313 N/A INTRINSIC
ZnF_C2H2 387 409 1.04e-3 SMART
ZnF_C2H2 415 437 2.15e-5 SMART
ZnF_C2H2 573 595 5.34e0 SMART
ZnF_C2H2 601 623 1.22e-4 SMART
ZnF_C2H2 633 655 1.84e-4 SMART
low complexity region 855 867 N/A INTRINSIC
ZnF_C2H2 880 902 2.53e-2 SMART
ZnF_C2H2 908 930 1.13e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000075044
SMART Domains Protein: ENSMUSP00000074556
Gene: ENSMUSG00000027547

DomainStartEndE-ValueType
low complexity region 15 24 N/A INTRINSIC
low complexity region 30 38 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
ZnF_C2H2 91 113 2.53e-2 SMART
ZnF_C2H2 119 141 1.13e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103074
SMART Domains Protein: ENSMUSP00000099363
Gene: ENSMUSG00000027547

DomainStartEndE-ValueType
low complexity region 15 24 N/A INTRINSIC
low complexity region 25 42 N/A INTRINSIC
ZnF_C2H2 68 88 1.31e2 SMART
low complexity region 193 203 N/A INTRINSIC
low complexity region 210 230 N/A INTRINSIC
low complexity region 254 278 N/A INTRINSIC
low complexity region 295 313 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
ZnF_C2H2 436 458 2.53e-2 SMART
ZnF_C2H2 464 486 1.13e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137536
SMART Domains Protein: ENSMUSP00000115646
Gene: ENSMUSG00000027547

DomainStartEndE-ValueType
Blast:ZnF_C2H2 37 61 6e-9 BLAST
low complexity region 162 172 N/A INTRINSIC
low complexity region 179 199 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150588
AA Change: K80E

PolyPhen 2 Score 0.253 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000119628
Gene: ENSMUSG00000027547
AA Change: K80E

DomainStartEndE-ValueType
ZnF_C2H2 64 86 1.22e-4 SMART
ZnF_C2H2 96 118 1.84e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene belongs to the spalt family of zinc finger transcription factors. In mouse, functions for this gene have been described in many embryonic developmental processes, including brain, heart, and limb development. In addition, this gene is an important pluripotency factor that is required for stem cell maintenance. Homozygous mutant mice display embryonic lethality, while conditional knock-out in embryonic germ cells results in failure to establish a robust stem cell population. A pseudogene of this gene is found on chromosome 2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous mutation of this gene results in early embryonic lethality before somite formation. Heterozygous mutation of this locus causes variable phenotypes, from heart and digit defects to deafness, anogenital tract defects, cranial and carpal bone defects and renal agenesis or hypoplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T G 10: 79,067,091 T464P probably damaging Het
Abca16 A G 7: 120,527,727 I1214V probably benign Het
Arap2 A G 5: 62,676,517 F869S probably damaging Het
Astn2 G T 4: 65,992,303 H431N possibly damaging Het
Bap1 A G 14: 31,255,651 T308A probably benign Het
Bcr G A 10: 75,131,036 E492K possibly damaging Het
Camta1 A G 4: 151,145,044 F444L probably damaging Het
Chd7 A T 4: 8,844,525 T1545S probably benign Het
Dnmt1 A T 9: 20,915,814 Y877* probably null Het
Fam13b A G 18: 34,497,447 V86A possibly damaging Het
Gm11562 T A 11: 99,619,991 R128W unknown Het
Krt86 A G 15: 101,473,833 I95V probably benign Het
Mgea5 G A 19: 45,767,476 A576V probably benign Het
Mroh2b A G 15: 4,912,802 T349A possibly damaging Het
Ms4a7 A T 19: 11,333,241 L38Q probably damaging Het
Myo1h T C 5: 114,330,160 S339P probably damaging Het
Nf2 T C 11: 4,799,944 I46V probably benign Het
Nr1h4 T C 10: 89,454,930 D416G probably benign Het
Olfr1179 A G 2: 88,402,295 M213T probably benign Het
Olfr323 T C 11: 58,625,458 E196G probably damaging Het
Pde1c C G 6: 56,442,035 E87Q possibly damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Pga5 A T 19: 10,669,415 D317E probably benign Het
Pira2 T A 7: 3,841,068 K568N probably damaging Het
Ppp2cb A G 8: 33,619,133 D290G probably benign Het
Slc7a14 G A 3: 31,223,579 P626S possibly damaging Het
Speer4b A T 5: 27,497,078 L228* probably null Het
Spns2 T C 11: 72,489,621 T59A probably benign Het
Tbc1d5 A T 17: 50,968,232 N78K probably benign Het
Tmem63a T C 1: 180,961,121 V341A probably benign Het
Trpt1 A G 19: 6,998,315 T146A probably benign Het
Tyrp1 T C 4: 80,835,437 C122R probably damaging Het
Uchl1 A G 5: 66,682,475 E120G possibly damaging Het
Ucn3 C T 13: 3,941,295 R119Q possibly damaging Het
Uhrf1bp1l A G 10: 89,806,117 D1050G probably benign Het
Vmn2r2 T G 3: 64,117,187 I658L probably benign Het
Vmn2r96 T A 17: 18,583,820 V444E probably benign Het
Wdr54 A C 6: 83,155,647 probably null Het
Xcr1 A G 9: 123,856,235 L154P probably benign Het
Zbtb26 T C 2: 37,436,545 K160E probably benign Het
Zfp157 T G 5: 138,456,510 Y323* probably null Het
Zfp850 A T 7: 27,990,376 F136I probably benign Het
Other mutations in Sall4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Sall4 APN 2 168755312 missense probably benign 0.02
IGL00592:Sall4 APN 2 168755963 missense probably damaging 1.00
IGL00674:Sall4 APN 2 168755780 missense probably damaging 0.99
IGL01308:Sall4 APN 2 168750244 missense probably damaging 0.99
IGL01538:Sall4 APN 2 168755856 missense probably damaging 1.00
IGL01552:Sall4 APN 2 168756123 missense probably damaging 1.00
IGL02614:Sall4 APN 2 168755885 missense probably null 0.79
R0514:Sall4 UTSW 2 168755705 missense probably damaging 1.00
R0531:Sall4 UTSW 2 168756336 missense probably benign 0.10
R0747:Sall4 UTSW 2 168754966 missense probably damaging 1.00
R1371:Sall4 UTSW 2 168756474 missense probably benign 0.10
R1736:Sall4 UTSW 2 168752635 missense probably benign 0.10
R2067:Sall4 UTSW 2 168756545 missense probably benign 0.00
R3766:Sall4 UTSW 2 168756044 missense possibly damaging 0.93
R3783:Sall4 UTSW 2 168756123 missense probably damaging 1.00
R3784:Sall4 UTSW 2 168756123 missense probably damaging 1.00
R3785:Sall4 UTSW 2 168756123 missense probably damaging 1.00
R3787:Sall4 UTSW 2 168756123 missense probably damaging 1.00
R3877:Sall4 UTSW 2 168756242 missense probably damaging 1.00
R4356:Sall4 UTSW 2 168755480 missense probably benign 0.37
R4358:Sall4 UTSW 2 168755480 missense probably benign 0.37
R4760:Sall4 UTSW 2 168750427 missense probably damaging 0.98
R4869:Sall4 UTSW 2 168755717 missense probably damaging 1.00
R5979:Sall4 UTSW 2 168750343 missense probably benign 0.28
R6089:Sall4 UTSW 2 168755486 missense possibly damaging 0.92
R6502:Sall4 UTSW 2 168755708 missense probably damaging 1.00
R7999:Sall4 UTSW 2 168752641 missense probably damaging 0.99
R8436:Sall4 UTSW 2 168755910 missense probably damaging 1.00
Z1177:Sall4 UTSW 2 168752575 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCTGAGAACAGACCTCCTCG -3'
(R):5'- ATTGCAGCAACTAGTGGAGAAC -3'

Sequencing Primer
(F):5'- GAGAACAGACCTCCTCGGCTTC -3'
(R):5'- GAGAACATAGACAAGGCCACTACTG -3'
Posted On2018-11-28