Mutagenetix > Incidental Mutation

Incidental Mutation 'R6990:Slc7a14'

543184

Institutional Source

Beutler Lab

Gene Symbol

Slc7a14

Ensembl Gene

ENSMUSG00000069072

Gene Name

solute carrier family 7 (cationic amino acid transporter, y+ system), member 14

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.159) question?

Stock #

R6990 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

31202858-31310378 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 31223579 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 626 (P626S)

Ref Sequence

ENSEMBL: ENSMUSP00000088803 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091259] [ENSMUST00000108245]

AlphaFold

Q8BXR1

Predicted Effect

possibly damaging
Transcript: ENSMUST00000091259
AA Change: P626S

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000088803
Gene: ENSMUSG00000069072
AA Change: P626S

Domain	Start	End	E-Value	Type
Pfam:AA_permease_2	53	443	2.1e-44	PFAM
Pfam:AA_permease	57	436	7.2e-38	PFAM
transmembrane domain	563	585	N/A	INTRINSIC
transmembrane domain	595	617	N/A	INTRINSIC
Pfam:AA_permease_C	627	677	9.2e-21	PFAM
low complexity region	737	757	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000108245
AA Change: P626S

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000103880
Gene: ENSMUSG00000069072
AA Change: P626S

Domain	Start	End	E-Value	Type
Pfam:AA_permease_2	53	445	2.5e-46	PFAM
Pfam:AA_permease	57	437	6.9e-41	PFAM
transmembrane domain	563	585	N/A	INTRINSIC
transmembrane domain	595	617	N/A	INTRINSIC
Pfam:AA_permease_C	627	668	1.4e-17	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is predicted to encode a glycosylated, cationic amino acid transporter protein with 14 transmembrane domains. This gene is primarily expressed in skin fibroblasts, neural tissue, and primary endothelial cells and its protein is predicted to mediate lysosomal uptake of cationic amino acids. Mutations in this gene are associated with autosomal recessive retinitis pigmentosa. In mice, this gene is expressed in the photoreceptor layer of the retina where its expression increases over the course of retinal development and persists in the mature retina. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal eye electrophysiology, thin retinal outer nuclear and decreased total retinal thickness. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610008E11Rik	T	G	10: 79,067,091	T464P	probably damaging	Het
Abca16	A	G	7: 120,527,727	I1214V	probably benign	Het
Arap2	A	G	5: 62,676,517	F869S	probably damaging	Het
Astn2	G	T	4: 65,992,303	H431N	possibly damaging	Het
Bap1	A	G	14: 31,255,651	T308A	probably benign	Het
Bcr	G	A	10: 75,131,036	E492K	possibly damaging	Het
Camta1	A	G	4: 151,145,044	F444L	probably damaging	Het
Chd7	A	T	4: 8,844,525	T1545S	probably benign	Het
Dnmt1	A	T	9: 20,915,814	Y877*	probably null	Het
Fam13b	A	G	18: 34,497,447	V86A	possibly damaging	Het
Gm11562	T	A	11: 99,619,991	R128W	unknown	Het
Krt86	A	G	15: 101,473,833	I95V	probably benign	Het
Mgea5	G	A	19: 45,767,476	A576V	probably benign	Het
Mroh2b	A	G	15: 4,912,802	T349A	possibly damaging	Het
Ms4a7	A	T	19: 11,333,241	L38Q	probably damaging	Het
Myo1h	T	C	5: 114,330,160	S339P	probably damaging	Het
Nf2	T	C	11: 4,799,944	I46V	probably benign	Het
Nr1h4	T	C	10: 89,454,930	D416G	probably benign	Het
Olfr1179	A	G	2: 88,402,295	M213T	probably benign	Het
Olfr323	T	C	11: 58,625,458	E196G	probably damaging	Het
Pde1c	C	G	6: 56,442,035	E87Q	possibly damaging	Het
Peg10	T	TCCA	6: 4,756,451		probably benign	Het
Pga5	A	T	19: 10,669,415	D317E	probably benign	Het
Pira2	T	A	7: 3,841,068	K568N	probably damaging	Het
Ppp2cb	A	G	8: 33,619,133	D290G	probably benign	Het
Sall4	T	C	2: 168,755,070	K617E	probably damaging	Het
Speer4b	A	T	5: 27,497,078	L228*	probably null	Het
Spns2	T	C	11: 72,489,621	T59A	probably benign	Het
Tbc1d5	A	T	17: 50,968,232	N78K	probably benign	Het
Tmem63a	T	C	1: 180,961,121	V341A	probably benign	Het
Trpt1	A	G	19: 6,998,315	T146A	probably benign	Het
Tyrp1	T	C	4: 80,835,437	C122R	probably damaging	Het
Uchl1	A	G	5: 66,682,475	E120G	possibly damaging	Het
Ucn3	C	T	13: 3,941,295	R119Q	possibly damaging	Het
Uhrf1bp1l	A	G	10: 89,806,117	D1050G	probably benign	Het
Vmn2r2	T	G	3: 64,117,187	I658L	probably benign	Het
Vmn2r96	T	A	17: 18,583,820	V444E	probably benign	Het
Wdr54	A	C	6: 83,155,647		probably null	Het
Xcr1	A	G	9: 123,856,235	L154P	probably benign	Het
Zbtb26	T	C	2: 37,436,545	K160E	probably benign	Het
Zfp157	T	G	5: 138,456,510	Y323*	probably null	Het
Zfp850	A	T	7: 27,990,376	F136I	probably benign	Het

Other mutations in Slc7a14

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02631:Slc7a14	APN	3	31238678	missense	probably damaging	1.00
IGL02713:Slc7a14	APN	3	31257763	missense	probably damaging	0.96
IGL03341:Slc7a14	APN	3	31238770	missense	probably damaging	1.00
IGL03350:Slc7a14	APN	3	31237409	missense	probably benign	0.35
IGL03379:Slc7a14	APN	3	31223515	missense	probably damaging	1.00
R0064:Slc7a14	UTSW	3	31227060	missense	probably damaging	1.00
R1549:Slc7a14	UTSW	3	31224118	missense	possibly damaging	0.94
R1591:Slc7a14	UTSW	3	31237449	missense	probably damaging	1.00
R2054:Slc7a14	UTSW	3	31237362	splice site	probably benign
R2057:Slc7a14	UTSW	3	31237496	missense	probably damaging	1.00
R2442:Slc7a14	UTSW	3	31230320	missense	probably damaging	1.00
R2504:Slc7a14	UTSW	3	31237501	missense	possibly damaging	0.85
R3848:Slc7a14	UTSW	3	31237474	missense	probably damaging	1.00
R4653:Slc7a14	UTSW	3	31257682	missense	probably damaging	1.00
R4702:Slc7a14	UTSW	3	31230398	missense	probably damaging	1.00
R5043:Slc7a14	UTSW	3	31237466	missense	probably damaging	1.00
R5187:Slc7a14	UTSW	3	31237365	splice site	probably null
R5345:Slc7a14	UTSW	3	31223857	missense	probably damaging	0.99
R5393:Slc7a14	UTSW	3	31257770	missense	probably damaging	1.00
R5421:Slc7a14	UTSW	3	31224197	missense	probably damaging	1.00
R5736:Slc7a14	UTSW	3	31223910	missense	probably benign	0.00
R5771:Slc7a14	UTSW	3	31238707	missense	probably damaging	1.00
R5896:Slc7a14	UTSW	3	31257570	missense	probably damaging	1.00
R5996:Slc7a14	UTSW	3	31209236	missense	probably benign
R6020:Slc7a14	UTSW	3	31224112	missense	probably benign
R6107:Slc7a14	UTSW	3	31257610	missense	probably damaging	1.00
R6140:Slc7a14	UTSW	3	31237548	missense	probably benign
R6491:Slc7a14	UTSW	3	31223944	missense	probably damaging	1.00
R6846:Slc7a14	UTSW	3	31224223	missense	probably damaging	1.00
R7184:Slc7a14	UTSW	3	31227063	missense	probably damaging	0.98
R7271:Slc7a14	UTSW	3	31224235	missense	probably damaging	1.00
R7282:Slc7a14	UTSW	3	31227153	missense	possibly damaging	0.67
R7331:Slc7a14	UTSW	3	31257731	missense	probably benign	0.00
R8227:Slc7a14	UTSW	3	31209212	missense	probably benign	0.00
R8238:Slc7a14	UTSW	3	31227151	missense	probably benign	0.01
R8524:Slc7a14	UTSW	3	31224133	missense	possibly damaging	0.70
R8843:Slc7a14	UTSW	3	31257610	missense	probably damaging	1.00
R8903:Slc7a14	UTSW	3	31223446	missense	probably damaging	0.98
R9011:Slc7a14	UTSW	3	31224196	missense	probably damaging	1.00
R9208:Slc7a14	UTSW	3	31227210	missense	probably damaging	1.00
R9633:Slc7a14	UTSW	3	31224017	missense	probably benign	0.31
Z1088:Slc7a14	UTSW	3	31223999	missense	probably benign	0.10

Predicted Primers

PCR Primer
(F):5'- TTGGGATAAGCCTGTTCAAGAC -3'
(R):5'- TTCCAGGCAAAATGGACCGG -3'

Sequencing Primer
(F):5'- AAGCCTGTTCAAGACCTTAAAAG -3'
(R):5'- ACACGGTGACCATCTGCG -3'

Posted On

2018-11-28