Incidental Mutation 'R6990:Vmn2r2'
ID543185
Institutional Source Beutler Lab
Gene Symbol Vmn2r2
Ensembl Gene ENSMUSG00000043897
Gene Namevomeronasal 2, receptor 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R6990 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location64116432-64140543 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 64117187 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 658 (I658L)
Ref Sequence ENSEMBL: ENSMUSP00000135110 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077958] [ENSMUST00000177151]
Predicted Effect probably benign
Transcript: ENSMUST00000077958
AA Change: I574L

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000077109
Gene: ENSMUSG00000043897
AA Change: I574L

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 416 4.5e-80 PFAM
Pfam:NCD3G 458 511 8.3e-18 PFAM
Pfam:7tm_3 542 779 1.3e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177151
AA Change: I658L

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000135110
Gene: ENSMUSG00000043897
AA Change: I658L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 83 500 1.6e-84 PFAM
Pfam:NCD3G 542 595 2.6e-17 PFAM
Pfam:7tm_3 628 862 1.9e-47 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T G 10: 79,067,091 T464P probably damaging Het
Abca16 A G 7: 120,527,727 I1214V probably benign Het
Arap2 A G 5: 62,676,517 F869S probably damaging Het
Astn2 G T 4: 65,992,303 H431N possibly damaging Het
Bap1 A G 14: 31,255,651 T308A probably benign Het
Bcr G A 10: 75,131,036 E492K possibly damaging Het
Camta1 A G 4: 151,145,044 F444L probably damaging Het
Chd7 A T 4: 8,844,525 T1545S probably benign Het
Dnmt1 A T 9: 20,915,814 Y877* probably null Het
Fam13b A G 18: 34,497,447 V86A possibly damaging Het
Gm11562 T A 11: 99,619,991 R128W unknown Het
Krt86 A G 15: 101,473,833 I95V probably benign Het
Mgea5 G A 19: 45,767,476 A576V probably benign Het
Mroh2b A G 15: 4,912,802 T349A possibly damaging Het
Ms4a7 A T 19: 11,333,241 L38Q probably damaging Het
Myo1h T C 5: 114,330,160 S339P probably damaging Het
Nf2 T C 11: 4,799,944 I46V probably benign Het
Nr1h4 T C 10: 89,454,930 D416G probably benign Het
Olfr1179 A G 2: 88,402,295 M213T probably benign Het
Olfr323 T C 11: 58,625,458 E196G probably damaging Het
Pde1c C G 6: 56,442,035 E87Q possibly damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Pga5 A T 19: 10,669,415 D317E probably benign Het
Pira2 T A 7: 3,841,068 K568N probably damaging Het
Ppp2cb A G 8: 33,619,133 D290G probably benign Het
Sall4 T C 2: 168,755,070 K617E probably damaging Het
Slc7a14 G A 3: 31,223,579 P626S possibly damaging Het
Speer4b A T 5: 27,497,078 L228* probably null Het
Spns2 T C 11: 72,489,621 T59A probably benign Het
Tbc1d5 A T 17: 50,968,232 N78K probably benign Het
Tmem63a T C 1: 180,961,121 V341A probably benign Het
Trpt1 A G 19: 6,998,315 T146A probably benign Het
Tyrp1 T C 4: 80,835,437 C122R probably damaging Het
Uchl1 A G 5: 66,682,475 E120G possibly damaging Het
Ucn3 C T 13: 3,941,295 R119Q possibly damaging Het
Uhrf1bp1l A G 10: 89,806,117 D1050G probably benign Het
Vmn2r96 T A 17: 18,583,820 V444E probably benign Het
Wdr54 A C 6: 83,155,647 probably null Het
Xcr1 A G 9: 123,856,235 L154P probably benign Het
Zbtb26 T C 2: 37,436,545 K160E probably benign Het
Zfp157 T G 5: 138,456,510 Y323* probably null Het
Zfp850 A T 7: 27,990,376 F136I probably benign Het
Other mutations in Vmn2r2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Vmn2r2 APN 3 64133898 splice site probably benign
IGL00980:Vmn2r2 APN 3 64117180 missense probably benign 0.11
IGL01389:Vmn2r2 APN 3 64117009 missense probably damaging 0.97
IGL01804:Vmn2r2 APN 3 64134256 missense possibly damaging 0.91
IGL02750:Vmn2r2 APN 3 64117402 missense probably damaging 1.00
IGL02829:Vmn2r2 APN 3 64118751 splice site probably benign
IGL03036:Vmn2r2 APN 3 64116900 missense probably benign 0.01
IGL03174:Vmn2r2 APN 3 64117123 nonsense probably null
PIT4151001:Vmn2r2 UTSW 3 64116913 missense possibly damaging 0.67
R0029:Vmn2r2 UTSW 3 64116944 missense probably benign 0.00
R0310:Vmn2r2 UTSW 3 64134618 missense probably damaging 1.00
R0357:Vmn2r2 UTSW 3 64133899 splice site probably null
R0637:Vmn2r2 UTSW 3 64126578 missense probably benign 0.00
R1626:Vmn2r2 UTSW 3 64134500 missense possibly damaging 0.61
R1662:Vmn2r2 UTSW 3 64117130 missense probably benign 0.00
R1710:Vmn2r2 UTSW 3 64117399 missense probably benign 0.19
R1797:Vmn2r2 UTSW 3 64134707 missense probably benign 0.00
R1862:Vmn2r2 UTSW 3 64134521 missense possibly damaging 0.79
R1971:Vmn2r2 UTSW 3 64126700 missense probably damaging 1.00
R2051:Vmn2r2 UTSW 3 64117345 missense possibly damaging 0.77
R2099:Vmn2r2 UTSW 3 64117053 missense probably damaging 1.00
R2275:Vmn2r2 UTSW 3 64116509 missense probably benign 0.00
R3078:Vmn2r2 UTSW 3 64134632 missense probably benign 0.22
R3418:Vmn2r2 UTSW 3 64116899 missense probably benign 0.00
R3419:Vmn2r2 UTSW 3 64116899 missense probably benign 0.00
R3959:Vmn2r2 UTSW 3 64140526 missense probably benign
R4230:Vmn2r2 UTSW 3 64134491 missense probably benign 0.00
R4258:Vmn2r2 UTSW 3 64134697 missense probably damaging 1.00
R4810:Vmn2r2 UTSW 3 64137462 missense probably damaging 1.00
R4822:Vmn2r2 UTSW 3 64134539 missense probably damaging 0.99
R4919:Vmn2r2 UTSW 3 64117157 missense possibly damaging 0.56
R4925:Vmn2r2 UTSW 3 64137471 start codon destroyed probably null 0.03
R4954:Vmn2r2 UTSW 3 64140484 missense probably benign 0.00
R5071:Vmn2r2 UTSW 3 64116900 missense probably benign 0.01
R5315:Vmn2r2 UTSW 3 64116956 missense probably benign 0.37
R5450:Vmn2r2 UTSW 3 64126590 missense probably benign
R5577:Vmn2r2 UTSW 3 64116995 missense probably benign 0.00
R5595:Vmn2r2 UTSW 3 64126615 missense possibly damaging 0.74
R5727:Vmn2r2 UTSW 3 64117187 missense probably benign 0.41
R5810:Vmn2r2 UTSW 3 64117394 missense probably damaging 1.00
R5919:Vmn2r2 UTSW 3 64137302 missense probably benign 0.39
R6052:Vmn2r2 UTSW 3 64117361 missense possibly damaging 0.56
R6084:Vmn2r2 UTSW 3 64117046 missense probably benign 0.01
R6299:Vmn2r2 UTSW 3 64116653 nonsense probably null
R6762:Vmn2r2 UTSW 3 64134449 missense probably damaging 1.00
R6858:Vmn2r2 UTSW 3 64137494 missense probably damaging 1.00
R6889:Vmn2r2 UTSW 3 64117267 missense probably damaging 0.99
R7195:Vmn2r2 UTSW 3 64116479 missense probably benign 0.01
R7269:Vmn2r2 UTSW 3 64126577 missense probably benign 0.32
R7717:Vmn2r2 UTSW 3 64134598 missense possibly damaging 0.95
R7798:Vmn2r2 UTSW 3 64134097 missense possibly damaging 0.60
X0024:Vmn2r2 UTSW 3 64137286 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTCCAACACCAAGTATGCTG -3'
(R):5'- AAGTGTGTGCCAAAGCTTGTG -3'

Sequencing Primer
(F):5'- CGCAGACCAGTACAATTAGTTTTCG -3'
(R):5'- GCCAAAGCTTGTGGAATTCC -3'
Posted On2018-11-28