Incidental Mutation 'R6990:Speer4b'
ID543190
Institutional Source Beutler Lab
Gene Symbol Speer4b
Ensembl Gene ENSMUSG00000048703
Gene Namespermatogenesis associated glutamate (E)-rich protein 4B
Synonyms1700081O22Rik, SPEER-4B
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R6990 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location27495639-27501438 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 27497078 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 228 (L228*)
Ref Sequence ENSEMBL: ENSMUSP00000062903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053257] [ENSMUST00000071500] [ENSMUST00000101471] [ENSMUST00000120555] [ENSMUST00000122171]
Predicted Effect probably null
Transcript: ENSMUST00000053257
AA Change: L228*
SMART Domains Protein: ENSMUSP00000062903
Gene: ENSMUSG00000048703
AA Change: L228*

DomainStartEndE-ValueType
Pfam:Takusan 50 134 9.6e-27 PFAM
low complexity region 154 168 N/A INTRINSIC
low complexity region 235 259 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000071500
SMART Domains Protein: ENSMUSP00000071435
Gene: ENSMUSG00000061576

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
Pfam:DPPIV_N 134 500 7.2e-114 PFAM
Pfam:PD40 365 402 1.1e-5 PFAM
Pfam:Peptidase_S9 579 789 2.9e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101471
SMART Domains Protein: ENSMUSP00000099012
Gene: ENSMUSG00000061576

DomainStartEndE-ValueType
transmembrane domain 34 56 N/A INTRINSIC
Pfam:DPPIV_N 133 499 2.6e-114 PFAM
Pfam:PD40 364 401 9.3e-6 PFAM
Pfam:Peptidase_S9 578 788 1.9e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120555
SMART Domains Protein: ENSMUSP00000113849
Gene: ENSMUSG00000061576

DomainStartEndE-ValueType
transmembrane domain 32 54 N/A INTRINSIC
Pfam:DPPIV_N 131 497 2.6e-114 PFAM
Pfam:PD40 362 399 9.2e-6 PFAM
Pfam:Peptidase_S9 576 786 1.9e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122171
SMART Domains Protein: ENSMUSP00000113441
Gene: ENSMUSG00000061576

DomainStartEndE-ValueType
low complexity region 50 62 N/A INTRINSIC
transmembrane domain 90 112 N/A INTRINSIC
Pfam:DPPIV_N 189 555 6.4e-113 PFAM
Pfam:PD40 425 457 1.1e-4 PFAM
Pfam:Peptidase_S9 634 844 4.3e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155721
SMART Domains Protein: ENSMUSP00000122872
Gene: ENSMUSG00000048703

DomainStartEndE-ValueType
Pfam:Takusan 49 133 6.2e-27 PFAM
low complexity region 153 167 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T G 10: 79,067,091 T464P probably damaging Het
Abca16 A G 7: 120,527,727 I1214V probably benign Het
Arap2 A G 5: 62,676,517 F869S probably damaging Het
Astn2 G T 4: 65,992,303 H431N possibly damaging Het
Bap1 A G 14: 31,255,651 T308A probably benign Het
Bcr G A 10: 75,131,036 E492K possibly damaging Het
Camta1 A G 4: 151,145,044 F444L probably damaging Het
Chd7 A T 4: 8,844,525 T1545S probably benign Het
Dnmt1 A T 9: 20,915,814 Y877* probably null Het
Fam13b A G 18: 34,497,447 V86A possibly damaging Het
Gm11562 T A 11: 99,619,991 R128W unknown Het
Krt86 A G 15: 101,473,833 I95V probably benign Het
Mgea5 G A 19: 45,767,476 A576V probably benign Het
Mroh2b A G 15: 4,912,802 T349A possibly damaging Het
Ms4a7 A T 19: 11,333,241 L38Q probably damaging Het
Myo1h T C 5: 114,330,160 S339P probably damaging Het
Nf2 T C 11: 4,799,944 I46V probably benign Het
Nr1h4 T C 10: 89,454,930 D416G probably benign Het
Olfr1179 A G 2: 88,402,295 M213T probably benign Het
Olfr323 T C 11: 58,625,458 E196G probably damaging Het
Pde1c C G 6: 56,442,035 E87Q possibly damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Pga5 A T 19: 10,669,415 D317E probably benign Het
Pira2 T A 7: 3,841,068 K568N probably damaging Het
Ppp2cb A G 8: 33,619,133 D290G probably benign Het
Sall4 T C 2: 168,755,070 K617E probably damaging Het
Slc7a14 G A 3: 31,223,579 P626S possibly damaging Het
Spns2 T C 11: 72,489,621 T59A probably benign Het
Tbc1d5 A T 17: 50,968,232 N78K probably benign Het
Tmem63a T C 1: 180,961,121 V341A probably benign Het
Trpt1 A G 19: 6,998,315 T146A probably benign Het
Tyrp1 T C 4: 80,835,437 C122R probably damaging Het
Uchl1 A G 5: 66,682,475 E120G possibly damaging Het
Ucn3 C T 13: 3,941,295 R119Q possibly damaging Het
Uhrf1bp1l A G 10: 89,806,117 D1050G probably benign Het
Vmn2r2 T G 3: 64,117,187 I658L probably benign Het
Vmn2r96 T A 17: 18,583,820 V444E probably benign Het
Wdr54 A C 6: 83,155,647 probably null Het
Xcr1 A G 9: 123,856,235 L154P probably benign Het
Zbtb26 T C 2: 37,436,545 K160E probably benign Het
Zfp157 T G 5: 138,456,510 Y323* probably null Het
Zfp850 A T 7: 27,990,376 F136I probably benign Het
Other mutations in Speer4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00869:Speer4b APN 5 27498718 missense probably damaging 0.99
IGL00990:Speer4b APN 5 27501274 missense probably damaging 1.00
IGL01343:Speer4b APN 5 27497883 missense probably benign
R1586:Speer4b UTSW 5 27497013 missense probably damaging 0.98
R1772:Speer4b UTSW 5 27500238 splice site probably benign
R4239:Speer4b UTSW 5 27501313 missense probably benign 0.17
R4585:Speer4b UTSW 5 27498038 missense probably null 1.00
R4586:Speer4b UTSW 5 27498038 missense probably null 1.00
R4659:Speer4b UTSW 5 27497895 missense probably benign
R4915:Speer4b UTSW 5 27500136 missense probably benign 0.00
R4927:Speer4b UTSW 5 27501265 missense probably damaging 0.97
R5619:Speer4b UTSW 5 27498817 missense possibly damaging 0.84
R5860:Speer4b UTSW 5 27500228 missense possibly damaging 0.60
R7045:Speer4b UTSW 5 27500125 missense probably damaging 1.00
R7146:Speer4b UTSW 5 27498710 missense probably benign 0.00
R7170:Speer4b UTSW 5 27498823 missense possibly damaging 0.70
R8437:Speer4b UTSW 5 27498820 missense probably benign 0.01
Z1088:Speer4b UTSW 5 27497941 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CAAGAGTCGTTGCCTGAAGAG -3'
(R):5'- TGAATACTTTGCCTGTCTGCAG -3'

Sequencing Primer
(F):5'- TCGTTGCCTGAAGAGAAAAGG -3'
(R):5'- GCCTGTCTGCAGTTTTCAAATCTG -3'
Posted On2018-11-28