Incidental Mutation 'R6990:Uchl1'
ID543192
Institutional Source Beutler Lab
Gene Symbol Uchl1
Ensembl Gene ENSMUSG00000029223
Gene Nameubiquitin carboxy-terminal hydrolase L1
SynonymsPGP 9.5, PGP9.5
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6990 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location66676091-66687234 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 66682475 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 120 (E120G)
Ref Sequence ENSEMBL: ENSMUSP00000031131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031131]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031131
AA Change: E120G

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000031131
Gene: ENSMUSG00000029223
AA Change: E120G

DomainStartEndE-ValueType
Pfam:Peptidase_C12 3 206 3e-61 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the peptidase C12 family. This enzyme is a thiol protease that hydrolyzes a peptide bond at the C-terminal glycine of ubiquitin. This gene is specifically expressed in the neurons and in cells of the diffuse neuroendocrine system. Mutations in this gene may be associated with Parkinson disease.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for one allele show ataxia beginning at 80 days of age, followed by progressive tremors, impaired locomotion, atrophy of hind limb muscles, and death by 5-6 months. Mice homozygous for a second allele exhibit defects in motor coordinationand decreases in thermal pain sensation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T G 10: 79,067,091 T464P probably damaging Het
Abca16 A G 7: 120,527,727 I1214V probably benign Het
Arap2 A G 5: 62,676,517 F869S probably damaging Het
Astn2 G T 4: 65,992,303 H431N possibly damaging Het
Bap1 A G 14: 31,255,651 T308A probably benign Het
Bcr G A 10: 75,131,036 E492K possibly damaging Het
Camta1 A G 4: 151,145,044 F444L probably damaging Het
Chd7 A T 4: 8,844,525 T1545S probably benign Het
Dnmt1 A T 9: 20,915,814 Y877* probably null Het
Fam13b A G 18: 34,497,447 V86A possibly damaging Het
Gm11562 T A 11: 99,619,991 R128W unknown Het
Krt86 A G 15: 101,473,833 I95V probably benign Het
Mgea5 G A 19: 45,767,476 A576V probably benign Het
Mroh2b A G 15: 4,912,802 T349A possibly damaging Het
Ms4a7 A T 19: 11,333,241 L38Q probably damaging Het
Myo1h T C 5: 114,330,160 S339P probably damaging Het
Nf2 T C 11: 4,799,944 I46V probably benign Het
Nr1h4 T C 10: 89,454,930 D416G probably benign Het
Olfr1179 A G 2: 88,402,295 M213T probably benign Het
Olfr323 T C 11: 58,625,458 E196G probably damaging Het
Pde1c C G 6: 56,442,035 E87Q possibly damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Pga5 A T 19: 10,669,415 D317E probably benign Het
Pira2 T A 7: 3,841,068 K568N probably damaging Het
Ppp2cb A G 8: 33,619,133 D290G probably benign Het
Sall4 T C 2: 168,755,070 K617E probably damaging Het
Slc7a14 G A 3: 31,223,579 P626S possibly damaging Het
Speer4b A T 5: 27,497,078 L228* probably null Het
Spns2 T C 11: 72,489,621 T59A probably benign Het
Tbc1d5 A T 17: 50,968,232 N78K probably benign Het
Tmem63a T C 1: 180,961,121 V341A probably benign Het
Trpt1 A G 19: 6,998,315 T146A probably benign Het
Tyrp1 T C 4: 80,835,437 C122R probably damaging Het
Ucn3 C T 13: 3,941,295 R119Q possibly damaging Het
Uhrf1bp1l A G 10: 89,806,117 D1050G probably benign Het
Vmn2r2 T G 3: 64,117,187 I658L probably benign Het
Vmn2r96 T A 17: 18,583,820 V444E probably benign Het
Wdr54 A C 6: 83,155,647 probably null Het
Xcr1 A G 9: 123,856,235 L154P probably benign Het
Zbtb26 T C 2: 37,436,545 K160E probably benign Het
Zfp157 T G 5: 138,456,510 Y323* probably null Het
Zfp850 A T 7: 27,990,376 F136I probably benign Het
Other mutations in Uchl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02179:Uchl1 APN 5 66676294 missense probably benign 0.24
IGL02186:Uchl1 APN 5 66677039 nonsense probably null
IGL03268:Uchl1 APN 5 66682481 missense probably benign 0.03
R0556:Uchl1 UTSW 5 66682481 missense probably benign 0.06
R1075:Uchl1 UTSW 5 66682465 missense probably damaging 1.00
R1736:Uchl1 UTSW 5 66677074 critical splice donor site probably null
R2516:Uchl1 UTSW 5 66682613 missense probably damaging 1.00
R4888:Uchl1 UTSW 5 66676437 missense probably benign 0.32
R5121:Uchl1 UTSW 5 66676437 missense probably benign 0.32
R5569:Uchl1 UTSW 5 66686873 missense probably damaging 0.99
R5788:Uchl1 UTSW 5 66676411 intron probably benign
R6881:Uchl1 UTSW 5 66683722 missense probably damaging 0.99
R8807:Uchl1 UTSW 5 66676258 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TGATTTCAGCAGCAGGGAG -3'
(R):5'- GTATTTACCCGACACTGGCC -3'

Sequencing Primer
(F):5'- AGCCGTTGGGAAGCTAGC -3'
(R):5'- CGACACTGGCCCTCCTG -3'
Posted On2018-11-28