Incidental Mutation 'R6990:Zfp157'
ID543194
Institutional Source Beutler Lab
Gene Symbol Zfp157
Ensembl Gene ENSMUSG00000036898
Gene Namezinc finger protein 157
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R6990 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location138441468-138460694 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to G at 138456510 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 323 (Y323*)
Ref Sequence ENSEMBL: ENSMUSP00000083018 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085856] [ENSMUST00000100524] [ENSMUST00000110912]
Predicted Effect probably null
Transcript: ENSMUST00000085856
AA Change: Y323*
SMART Domains Protein: ENSMUSP00000083018
Gene: ENSMUSG00000036898
AA Change: Y323*

DomainStartEndE-ValueType
KRAB 4 64 3.64e-35 SMART
ZnF_C2H2 183 205 3.69e-4 SMART
ZnF_C2H2 211 233 3.16e-3 SMART
ZnF_C2H2 239 261 3.63e-3 SMART
ZnF_C2H2 267 289 2.24e-3 SMART
ZnF_C2H2 295 317 1.47e-3 SMART
ZnF_C2H2 323 345 1.95e-3 SMART
ZnF_C2H2 351 373 1.28e-3 SMART
ZnF_C2H2 379 401 2.4e-3 SMART
ZnF_C2H2 407 429 9.73e-4 SMART
ZnF_C2H2 435 457 4.4e-2 SMART
ZnF_C2H2 463 485 1.01e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100524
SMART Domains Protein: ENSMUSP00000098093
Gene: ENSMUSG00000036898

DomainStartEndE-ValueType
KRAB 4 64 3.64e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110912
SMART Domains Protein: ENSMUSP00000106537
Gene: ENSMUSG00000036898

DomainStartEndE-ValueType
KRAB 4 64 3.64e-35 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display accelerated ductal elongation during puberty and accelerated alveologenesis during pregnancy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T G 10: 79,067,091 T464P probably damaging Het
Abca16 A G 7: 120,527,727 I1214V probably benign Het
Arap2 A G 5: 62,676,517 F869S probably damaging Het
Astn2 G T 4: 65,992,303 H431N possibly damaging Het
Bap1 A G 14: 31,255,651 T308A probably benign Het
Bcr G A 10: 75,131,036 E492K possibly damaging Het
Camta1 A G 4: 151,145,044 F444L probably damaging Het
Chd7 A T 4: 8,844,525 T1545S probably benign Het
Dnmt1 A T 9: 20,915,814 Y877* probably null Het
Fam13b A G 18: 34,497,447 V86A possibly damaging Het
Gm11562 T A 11: 99,619,991 R128W unknown Het
Krt86 A G 15: 101,473,833 I95V probably benign Het
Mgea5 G A 19: 45,767,476 A576V probably benign Het
Mroh2b A G 15: 4,912,802 T349A possibly damaging Het
Ms4a7 A T 19: 11,333,241 L38Q probably damaging Het
Myo1h T C 5: 114,330,160 S339P probably damaging Het
Nf2 T C 11: 4,799,944 I46V probably benign Het
Nr1h4 T C 10: 89,454,930 D416G probably benign Het
Olfr1179 A G 2: 88,402,295 M213T probably benign Het
Olfr323 T C 11: 58,625,458 E196G probably damaging Het
Pde1c C G 6: 56,442,035 E87Q possibly damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Pga5 A T 19: 10,669,415 D317E probably benign Het
Pira2 T A 7: 3,841,068 K568N probably damaging Het
Ppp2cb A G 8: 33,619,133 D290G probably benign Het
Sall4 T C 2: 168,755,070 K617E probably damaging Het
Slc7a14 G A 3: 31,223,579 P626S possibly damaging Het
Speer4b A T 5: 27,497,078 L228* probably null Het
Spns2 T C 11: 72,489,621 T59A probably benign Het
Tbc1d5 A T 17: 50,968,232 N78K probably benign Het
Tmem63a T C 1: 180,961,121 V341A probably benign Het
Trpt1 A G 19: 6,998,315 T146A probably benign Het
Tyrp1 T C 4: 80,835,437 C122R probably damaging Het
Uchl1 A G 5: 66,682,475 E120G possibly damaging Het
Ucn3 C T 13: 3,941,295 R119Q possibly damaging Het
Uhrf1bp1l A G 10: 89,806,117 D1050G probably benign Het
Vmn2r2 T G 3: 64,117,187 I658L probably benign Het
Vmn2r96 T A 17: 18,583,820 V444E probably benign Het
Wdr54 A C 6: 83,155,647 probably null Het
Xcr1 A G 9: 123,856,235 L154P probably benign Het
Zbtb26 T C 2: 37,436,545 K160E probably benign Het
Zfp850 A T 7: 27,990,376 F136I probably benign Het
Other mutations in Zfp157
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01322:Zfp157 APN 5 138447578 missense probably benign 0.02
IGL02377:Zfp157 APN 5 138447597 nonsense probably null
R1476:Zfp157 UTSW 5 138455095 critical splice donor site probably null
R1883:Zfp157 UTSW 5 138444840 missense probably damaging 1.00
R1884:Zfp157 UTSW 5 138444840 missense probably damaging 1.00
R3401:Zfp157 UTSW 5 138457011 missense probably benign 0.35
R4237:Zfp157 UTSW 5 138447541 missense probably damaging 1.00
R4239:Zfp157 UTSW 5 138447541 missense probably damaging 1.00
R4573:Zfp157 UTSW 5 138456929 missense probably damaging 0.97
R4785:Zfp157 UTSW 5 138444789 missense probably damaging 1.00
R4914:Zfp157 UTSW 5 138456295 missense possibly damaging 0.85
R5476:Zfp157 UTSW 5 138457181 missense possibly damaging 0.92
R6128:Zfp157 UTSW 5 138455019 missense possibly damaging 0.95
R6473:Zfp157 UTSW 5 138455926 missense probably damaging 0.99
R6572:Zfp157 UTSW 5 138457051 missense possibly damaging 0.92
R7638:Zfp157 UTSW 5 138455910 missense probably benign 0.04
R7966:Zfp157 UTSW 5 138447571 missense probably benign 0.14
R7994:Zfp157 UTSW 5 138455188 splice site probably null
R8057:Zfp157 UTSW 5 138456074 missense probably damaging 1.00
R8397:Zfp157 UTSW 5 138456256 missense probably damaging 1.00
Z1088:Zfp157 UTSW 5 138457199 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTTTCTCCTCCAAATCAGAACTCAC -3'
(R):5'- TCGGGCGAGTCCTGACTTG -3'

Sequencing Primer
(F):5'- TTCATACTGGTGAGAAGCCCCATG -3'
(R):5'- CTTGTAGAAGAAAGCCTTGCC -3'
Posted On2018-11-28