Incidental Mutation 'R6990:Pde1c'
ID543196
Institutional Source Beutler Lab
Gene Symbol Pde1c
Ensembl Gene ENSMUSG00000004347
Gene Namephosphodiesterase 1C
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.247) question?
Stock #R6990 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location56069804-56569103 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 56442035 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glutamine at position 87 (E87Q)
Ref Sequence ENSEMBL: ENSMUSP00000145508 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000203372]
Predicted Effect possibly damaging
Transcript: ENSMUST00000203372
AA Change: E87Q

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000145508
Gene: ENSMUSG00000004347
AA Change: E87Q

DomainStartEndE-ValueType
Pfam:PDEase_I_N 142 202 3.1e-31 PFAM
HDc 285 450 5.8e-8 SMART
Blast:HDc 462 741 1e-122 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that belongs to the 3'5'-cyclic nucleotide phosphodiesterase family. Members of this family catalyze hydrolysis of the cyclic nucleotides, cyclic adenosine monophosphate and cyclic guanosine monophosphate, to the corresponding nucleoside 5'-monophosphates. The enzyme encoded by this gene regulates proliferation and migration of vascular smooth muscle cells, and neointimal hyperplasia. This enzyme also plays a role in pathological vascular remodeling by regulating the stability of growth factor receptors, such as PDGF-receptor-beta. [provided by RefSeq, Jul 2016]
PHENOTYPE: Olfactory sensory nerves from homozygous null mice have significantly reduced action potentials in response to odor with slower onset kinetics and a faster response termination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T G 10: 79,067,091 T464P probably damaging Het
Abca16 A G 7: 120,527,727 I1214V probably benign Het
Arap2 A G 5: 62,676,517 F869S probably damaging Het
Astn2 G T 4: 65,992,303 H431N possibly damaging Het
Bap1 A G 14: 31,255,651 T308A probably benign Het
Bcr G A 10: 75,131,036 E492K possibly damaging Het
Camta1 A G 4: 151,145,044 F444L probably damaging Het
Chd7 A T 4: 8,844,525 T1545S probably benign Het
Dnmt1 A T 9: 20,915,814 Y877* probably null Het
Fam13b A G 18: 34,497,447 V86A possibly damaging Het
Gm11562 T A 11: 99,619,991 R128W unknown Het
Krt86 A G 15: 101,473,833 I95V probably benign Het
Mgea5 G A 19: 45,767,476 A576V probably benign Het
Mroh2b A G 15: 4,912,802 T349A possibly damaging Het
Ms4a7 A T 19: 11,333,241 L38Q probably damaging Het
Myo1h T C 5: 114,330,160 S339P probably damaging Het
Nf2 T C 11: 4,799,944 I46V probably benign Het
Nr1h4 T C 10: 89,454,930 D416G probably benign Het
Olfr1179 A G 2: 88,402,295 M213T probably benign Het
Olfr323 T C 11: 58,625,458 E196G probably damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Pga5 A T 19: 10,669,415 D317E probably benign Het
Pira2 T A 7: 3,841,068 K568N probably damaging Het
Ppp2cb A G 8: 33,619,133 D290G probably benign Het
Sall4 T C 2: 168,755,070 K617E probably damaging Het
Slc7a14 G A 3: 31,223,579 P626S possibly damaging Het
Speer4b A T 5: 27,497,078 L228* probably null Het
Spns2 T C 11: 72,489,621 T59A probably benign Het
Tbc1d5 A T 17: 50,968,232 N78K probably benign Het
Tmem63a T C 1: 180,961,121 V341A probably benign Het
Trpt1 A G 19: 6,998,315 T146A probably benign Het
Tyrp1 T C 4: 80,835,437 C122R probably damaging Het
Uchl1 A G 5: 66,682,475 E120G possibly damaging Het
Ucn3 C T 13: 3,941,295 R119Q possibly damaging Het
Uhrf1bp1l A G 10: 89,806,117 D1050G probably benign Het
Vmn2r2 T G 3: 64,117,187 I658L probably benign Het
Vmn2r96 T A 17: 18,583,820 V444E probably benign Het
Wdr54 A C 6: 83,155,647 probably null Het
Xcr1 A G 9: 123,856,235 L154P probably benign Het
Zbtb26 T C 2: 37,436,545 K160E probably benign Het
Zfp157 T G 5: 138,456,510 Y323* probably null Het
Zfp850 A T 7: 27,990,376 F136I probably benign Het
Other mutations in Pde1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Pde1c APN 6 56173674 missense probably damaging 1.00
IGL02316:Pde1c APN 6 56151351 missense possibly damaging 0.77
IGL02751:Pde1c APN 6 56181688 missense probably damaging 1.00
IGL02801:Pde1c APN 6 56173666 missense probably damaging 1.00
IGL02975:Pde1c APN 6 56158936 missense probably damaging 1.00
IGL03357:Pde1c APN 6 56180093 missense probably damaging 1.00
R0523:Pde1c UTSW 6 56174941 missense probably damaging 1.00
R0717:Pde1c UTSW 6 56123012 missense probably damaging 0.98
R0973:Pde1c UTSW 6 56361815 missense probably benign 0.00
R1344:Pde1c UTSW 6 56361767 missense probably benign 0.08
R1521:Pde1c UTSW 6 56173607 missense possibly damaging 0.91
R1818:Pde1c UTSW 6 56126892 nonsense probably null
R2004:Pde1c UTSW 6 56159011 missense probably damaging 1.00
R2026:Pde1c UTSW 6 56180190 missense probably damaging 1.00
R4380:Pde1c UTSW 6 56072278 missense probably null 0.02
R4729:Pde1c UTSW 6 56072209 missense probably damaging 1.00
R4847:Pde1c UTSW 6 56123034 missense possibly damaging 0.52
R4993:Pde1c UTSW 6 56150624 missense probably damaging 0.98
R5666:Pde1c UTSW 6 56126857 critical splice donor site probably null
R6005:Pde1c UTSW 6 56479202 splice site probably null
R6636:Pde1c UTSW 6 56180102 missense probably damaging 1.00
R6701:Pde1c UTSW 6 56181700 missense probably damaging 1.00
R7607:Pde1c UTSW 6 56150628 missense probably damaging 1.00
R7622:Pde1c UTSW 6 56126925 missense probably damaging 1.00
R8260:Pde1c UTSW 6 56137419 missense probably benign
R8416:Pde1c UTSW 6 56151291 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGTGAAAGTTACATGGGAGTCC -3'
(R):5'- TGCCTTGCATATCCTGGGTG -3'

Sequencing Primer
(F):5'- TGGGAGTCCAGTTAGTATTAATTCC -3'
(R):5'- CATATCCTGGGTGGGGATGAAG -3'
Posted On2018-11-28