Incidental Mutation 'R6990:Pira2'
ID543198
Institutional Source Beutler Lab
Gene Symbol Pira2
Ensembl Gene ENSMUSG00000089942
Gene Namepaired-Ig-like receptor A2
Synonyms6M23
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R6990 (G1)
Quality Score186.009
Status Not validated
Chromosome7
Chromosomal Location3836812-3845051 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 3841068 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 568 (K568N)
Ref Sequence ENSEMBL: ENSMUSP00000104255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108615] [ENSMUST00000119469]
Predicted Effect probably damaging
Transcript: ENSMUST00000108615
AA Change: K568N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104255
Gene: ENSMUSG00000089942
AA Change: K568N

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
IG 34 118 2.39e-1 SMART
IG_like 129 220 1.94e1 SMART
IG 231 315 7.77e-1 SMART
IG 328 415 3.36e0 SMART
IG_like 435 502 3.18e0 SMART
IG 529 618 8.59e-3 SMART
low complexity region 654 663 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119469
AA Change: K568N

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113857
Gene: ENSMUSG00000089942
AA Change: K568N

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
IG 34 118 2.39e-1 SMART
IG_like 129 220 1.94e1 SMART
IG 231 315 7.77e-1 SMART
IG 328 415 3.36e0 SMART
IG_like 435 502 3.18e0 SMART
IG 529 618 8.59e-3 SMART
low complexity region 637 646 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T G 10: 79,067,091 T464P probably damaging Het
Abca16 A G 7: 120,527,727 I1214V probably benign Het
Arap2 A G 5: 62,676,517 F869S probably damaging Het
Astn2 G T 4: 65,992,303 H431N possibly damaging Het
Bap1 A G 14: 31,255,651 T308A probably benign Het
Bcr G A 10: 75,131,036 E492K possibly damaging Het
Camta1 A G 4: 151,145,044 F444L probably damaging Het
Chd7 A T 4: 8,844,525 T1545S probably benign Het
Dnmt1 A T 9: 20,915,814 Y877* probably null Het
Fam13b A G 18: 34,497,447 V86A possibly damaging Het
Gm11562 T A 11: 99,619,991 R128W unknown Het
Krt86 A G 15: 101,473,833 I95V probably benign Het
Mgea5 G A 19: 45,767,476 A576V probably benign Het
Mroh2b A G 15: 4,912,802 T349A possibly damaging Het
Ms4a7 A T 19: 11,333,241 L38Q probably damaging Het
Myo1h T C 5: 114,330,160 S339P probably damaging Het
Nf2 T C 11: 4,799,944 I46V probably benign Het
Nr1h4 T C 10: 89,454,930 D416G probably benign Het
Olfr1179 A G 2: 88,402,295 M213T probably benign Het
Olfr323 T C 11: 58,625,458 E196G probably damaging Het
Pde1c C G 6: 56,442,035 E87Q possibly damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Pga5 A T 19: 10,669,415 D317E probably benign Het
Ppp2cb A G 8: 33,619,133 D290G probably benign Het
Sall4 T C 2: 168,755,070 K617E probably damaging Het
Slc7a14 G A 3: 31,223,579 P626S possibly damaging Het
Speer4b A T 5: 27,497,078 L228* probably null Het
Spns2 T C 11: 72,489,621 T59A probably benign Het
Tbc1d5 A T 17: 50,968,232 N78K probably benign Het
Tmem63a T C 1: 180,961,121 V341A probably benign Het
Trpt1 A G 19: 6,998,315 T146A probably benign Het
Tyrp1 T C 4: 80,835,437 C122R probably damaging Het
Uchl1 A G 5: 66,682,475 E120G possibly damaging Het
Ucn3 C T 13: 3,941,295 R119Q possibly damaging Het
Uhrf1bp1l A G 10: 89,806,117 D1050G probably benign Het
Vmn2r2 T G 3: 64,117,187 I658L probably benign Het
Vmn2r96 T A 17: 18,583,820 V444E probably benign Het
Wdr54 A C 6: 83,155,647 probably null Het
Xcr1 A G 9: 123,856,235 L154P probably benign Het
Zbtb26 T C 2: 37,436,545 K160E probably benign Het
Zfp157 T G 5: 138,456,510 Y323* probably null Het
Zfp850 A T 7: 27,990,376 F136I probably benign Het
Other mutations in Pira2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01349:Pira2 APN 7 3844139 missense probably damaging 1.00
IGL01810:Pira2 APN 7 3844612 missense probably damaging 1.00
IGL03167:Pira2 APN 7 3840920 missense probably damaging 0.98
IGL03171:Pira2 APN 7 3842605 missense probably damaging 1.00
BB009:Pira2 UTSW 7 3842436 critical splice donor site probably null
BB019:Pira2 UTSW 7 3842436 critical splice donor site probably null
PIT4260001:Pira2 UTSW 7 3842170 missense probably benign
PIT4260001:Pira2 UTSW 7 3842173 missense probably benign
PIT4260001:Pira2 UTSW 7 3842174 missense probably benign
R0517:Pira2 UTSW 7 3844197 splice site probably benign
R1565:Pira2 UTSW 7 3844549 missense probably damaging 1.00
R1870:Pira2 UTSW 7 3844453 missense probably damaging 1.00
R2143:Pira2 UTSW 7 3844345 missense probably damaging 1.00
R2144:Pira2 UTSW 7 3844345 missense probably damaging 1.00
R2145:Pira2 UTSW 7 3844345 missense probably damaging 1.00
R2149:Pira2 UTSW 7 3844171 missense probably damaging 1.00
R2171:Pira2 UTSW 7 3844418 missense probably benign 0.08
R3118:Pira2 UTSW 7 3841677 nonsense probably null
R4658:Pira2 UTSW 7 3840934 missense probably damaging 1.00
R5148:Pira2 UTSW 7 3844593 missense possibly damaging 0.62
R5228:Pira2 UTSW 7 3844374 missense probably benign 0.33
R5583:Pira2 UTSW 7 3842546 missense probably benign 0.34
R5974:Pira2 UTSW 7 3841577 missense probably benign 0.27
R6120:Pira2 UTSW 7 3841554 missense probably damaging 1.00
R6122:Pira2 UTSW 7 3842446 missense probably damaging 1.00
R6392:Pira2 UTSW 7 3843902 missense possibly damaging 0.72
R6658:Pira2 UTSW 7 3842301 missense probably benign 0.00
R6790:Pira2 UTSW 7 3842443 missense probably damaging 1.00
R7336:Pira2 UTSW 7 3844345 missense probably damaging 1.00
R7597:Pira2 UTSW 7 3842461 missense probably damaging 1.00
R7768:Pira2 UTSW 7 3841697 missense probably benign
R7777:Pira2 UTSW 7 3841697 missense probably benign
R7861:Pira2 UTSW 7 3844544 missense probably damaging 1.00
R7932:Pira2 UTSW 7 3842436 critical splice donor site probably null
R7977:Pira2 UTSW 7 3841697 missense probably benign
R7984:Pira2 UTSW 7 3841697 missense probably benign
R7985:Pira2 UTSW 7 3841697 missense probably benign
R7987:Pira2 UTSW 7 3841697 missense probably benign
R8017:Pira2 UTSW 7 3841697 missense probably benign
R8017:Pira2 UTSW 7 3841697 missense probably benign
R8019:Pira2 UTSW 7 3841697 missense probably benign
R8389:Pira2 UTSW 7 3843889 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAGTAAGAGCCCTGATACAG -3'
(R):5'- GGAAGCTAGCCTCTCATCATGC -3'

Sequencing Primer
(F):5'- GAGCCCTGATACAGTGTTAATTG -3'
(R):5'- ATGCCTCTTCTCTTTAGGACAG -3'
Posted On2018-11-28