Mutagenetix > Incidental Mutations

Incidental Mutation 'R6990:Xcr1'

543203

Institutional Source

Beutler Lab

Gene Symbol

Xcr1

Ensembl Gene

ENSMUSG00000060509

Gene Name

chemokine (C motif) receptor 1

Synonyms

Ccxcr1, XCR1, C motif-1/lymphotactin receptor, GPR5

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.083) question?

Stock #

R6990 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

123852315-123862029 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 123856235 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 154 (L154P)

Ref Sequence

ENSEMBL: ENSMUSP00000138255 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084715] [ENSMUST00000167595] [ENSMUST00000182350] [ENSMUST00000184082]

Predicted Effect

probably benign
Transcript: ENSMUST00000084715

SMART Domains

Protein: ENSMUSP00000081764
Gene: ENSMUSG00000025241

Domain	Start	End	E-Value	Type
Pfam:RUN	19	167	4.7e-12	PFAM
low complexity region	196	206	N/A	INTRINSIC
coiled coil region	223	270	N/A	INTRINSIC
coiled coil region	348	1110	N/A	INTRINSIC
FYVE	1124	1191	2.69e-16	SMART
PDB:1OLM\|E	1343	1428	1e-5	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000167595

SMART Domains

Protein: ENSMUSP00000133222
Gene: ENSMUSG00000025241

Domain	Start	End	E-Value	Type
Pfam:RUN	20	167	7.8e-12	PFAM
low complexity region	196	206	N/A	INTRINSIC
coiled coil region	223	270	N/A	INTRINSIC
coiled coil region	348	1110	N/A	INTRINSIC
FYVE	1124	1191	2.69e-16	SMART
PDB:1OLM\|E	1343	1428	1e-5	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000182350
AA Change: L154P

PolyPhen 2 Score 0.153 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000138255
Gene: ENSMUSG00000060509
AA Change: L154P

Domain	Start	End	E-Value	Type
low complexity region	48	59	N/A	INTRINSIC
Pfam:7tm_1	60	295	1.9e-45	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000184082

SMART Domains

Protein: ENSMUSP00000139343
Gene: ENSMUSG00000025241

Domain	Start	End	E-Value	Type
Pfam:RUN	7	167	4.5e-12	PFAM
low complexity region	196	206	N/A	INTRINSIC
coiled coil region	223	270	N/A	INTRINSIC
low complexity region	355	366	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a chemokine receptor belonging to the G protein-coupled receptor superfamily. The family members are characterized by the presence of 7 transmembrane domains and numerous conserved amino acids. This receptor is most closely related to RBS11 and the MIP1-alpha/RANTES receptor. It transduces a signal by increasing the intracellular calcium ions level. The viral macrophage inflammatory protein-II is an antagonist of this receptor and blocks signaling. Two alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit reduced CD8+ dendritic cell migration in response to XCL1. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610008E11Rik	T	G	10: 79,067,091	T464P	probably damaging	Het
Abca16	A	G	7: 120,527,727	I1214V	probably benign	Het
Arap2	A	G	5: 62,676,517	F869S	probably damaging	Het
Astn2	G	T	4: 65,992,303	H431N	possibly damaging	Het
Bap1	A	G	14: 31,255,651	T308A	probably benign	Het
Bcr	G	A	10: 75,131,036	E492K	possibly damaging	Het
Camta1	A	G	4: 151,145,044	F444L	probably damaging	Het
Chd7	A	T	4: 8,844,525	T1545S	probably benign	Het
Dnmt1	A	T	9: 20,915,814	Y877*	probably null	Het
Fam13b	A	G	18: 34,497,447	V86A	possibly damaging	Het
Gm11562	T	A	11: 99,619,991	R128W	unknown	Het
Krt86	A	G	15: 101,473,833	I95V	probably benign	Het
Mgea5	G	A	19: 45,767,476	A576V	probably benign	Het
Mroh2b	A	G	15: 4,912,802	T349A	possibly damaging	Het
Ms4a7	A	T	19: 11,333,241	L38Q	probably damaging	Het
Myo1h	T	C	5: 114,330,160	S339P	probably damaging	Het
Nf2	T	C	11: 4,799,944	I46V	probably benign	Het
Nr1h4	T	C	10: 89,454,930	D416G	probably benign	Het
Olfr1179	A	G	2: 88,402,295	M213T	probably benign	Het
Olfr323	T	C	11: 58,625,458	E196G	probably damaging	Het
Pde1c	C	G	6: 56,442,035	E87Q	possibly damaging	Het
Peg10	T	TCCA	6: 4,756,451		probably benign	Het
Pga5	A	T	19: 10,669,415	D317E	probably benign	Het
Pira2	T	A	7: 3,841,068	K568N	probably damaging	Het
Ppp2cb	A	G	8: 33,619,133	D290G	probably benign	Het
Sall4	T	C	2: 168,755,070	K617E	probably damaging	Het
Slc7a14	G	A	3: 31,223,579	P626S	possibly damaging	Het
Speer4b	A	T	5: 27,497,078	L228*	probably null	Het
Spns2	T	C	11: 72,489,621	T59A	probably benign	Het
Tbc1d5	A	T	17: 50,968,232	N78K	probably benign	Het
Tmem63a	T	C	1: 180,961,121	V341A	probably benign	Het
Trpt1	A	G	19: 6,998,315	T146A	probably benign	Het
Tyrp1	T	C	4: 80,835,437	C122R	probably damaging	Het
Uchl1	A	G	5: 66,682,475	E120G	possibly damaging	Het
Ucn3	C	T	13: 3,941,295	R119Q	possibly damaging	Het
Uhrf1bp1l	A	G	10: 89,806,117	D1050G	probably benign	Het
Vmn2r2	T	G	3: 64,117,187	I658L	probably benign	Het
Vmn2r96	T	A	17: 18,583,820	V444E	probably benign	Het
Wdr54	A	C	6: 83,155,647		probably null	Het
Zbtb26	T	C	2: 37,436,545	K160E	probably benign	Het
Zfp157	T	G	5: 138,456,510	Y323*	probably null	Het
Zfp850	A	T	7: 27,990,376	F136I	probably benign	Het

Other mutations in Xcr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL03324:Xcr1	APN	9	123856484	missense	probably benign	0.26
R0049:Xcr1	UTSW	9	123855875	missense	possibly damaging	0.49
R0049:Xcr1	UTSW	9	123855875	missense	possibly damaging	0.49
R0318:Xcr1	UTSW	9	123856154	missense	possibly damaging	0.92
R0683:Xcr1	UTSW	9	123855875	missense	probably benign	0.03
R4107:Xcr1	UTSW	9	123856088	missense	possibly damaging	0.67
R4127:Xcr1	UTSW	9	123856496	missense	probably damaging	1.00
R4859:Xcr1	UTSW	9	123856647	missense	probably benign
R5408:Xcr1	UTSW	9	123856566	missense	probably benign	0.00
R5419:Xcr1	UTSW	9	123856310	missense	probably benign	0.06
R5817:Xcr1	UTSW	9	123855857	missense	possibly damaging	0.94
R6051:Xcr1	UTSW	9	123856116	missense	probably benign	0.01
R6384:Xcr1	UTSW	9	123855782	missense	probably damaging	1.00
R6395:Xcr1	UTSW	9	123855789	missense	probably damaging	0.96
R6528:Xcr1	UTSW	9	123855983	missense	probably damaging	1.00
R6594:Xcr1	UTSW	9	123856244	missense	probably benign	0.00
R7648:Xcr1	UTSW	9	123856592	missense	possibly damaging	0.54

Predicted Primers

PCR Primer
(F):5'- TCTGGACCTTGTGCGAAAC -3'
(R):5'- TACTGCCTGTGTTGATCTCAGC -3'

Sequencing Primer
(F):5'- TTGTGCGAAACAAAGTCCTG -3'
(R):5'- TGTTGATCTCAGCACAATGGAG -3'

Posted On

2018-11-28