Incidental Mutation 'R6990:Xcr1'
ID 543203
Institutional Source Beutler Lab
Gene Symbol Xcr1
Ensembl Gene ENSMUSG00000060509
Gene Name chemokine (C motif) receptor 1
Synonyms Ccxcr1, XCR1, C motif-1/lymphotactin receptor, GPR5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock # R6990 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 123852315-123862029 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 123856235 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 154 (L154P)
Ref Sequence ENSEMBL: ENSMUSP00000138255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084715] [ENSMUST00000167595] [ENSMUST00000182350] [ENSMUST00000184082]
AlphaFold Q9R0M1
Predicted Effect probably benign
Transcript: ENSMUST00000084715
SMART Domains Protein: ENSMUSP00000081764
Gene: ENSMUSG00000025241

DomainStartEndE-ValueType
Pfam:RUN 19 167 4.7e-12 PFAM
low complexity region 196 206 N/A INTRINSIC
coiled coil region 223 270 N/A INTRINSIC
coiled coil region 348 1110 N/A INTRINSIC
FYVE 1124 1191 2.69e-16 SMART
PDB:1OLM|E 1343 1428 1e-5 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000167595
SMART Domains Protein: ENSMUSP00000133222
Gene: ENSMUSG00000025241

DomainStartEndE-ValueType
Pfam:RUN 20 167 7.8e-12 PFAM
low complexity region 196 206 N/A INTRINSIC
coiled coil region 223 270 N/A INTRINSIC
coiled coil region 348 1110 N/A INTRINSIC
FYVE 1124 1191 2.69e-16 SMART
PDB:1OLM|E 1343 1428 1e-5 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000182350
AA Change: L154P

PolyPhen 2 Score 0.153 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000138255
Gene: ENSMUSG00000060509
AA Change: L154P

DomainStartEndE-ValueType
low complexity region 48 59 N/A INTRINSIC
Pfam:7tm_1 60 295 1.9e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184082
SMART Domains Protein: ENSMUSP00000139343
Gene: ENSMUSG00000025241

DomainStartEndE-ValueType
Pfam:RUN 7 167 4.5e-12 PFAM
low complexity region 196 206 N/A INTRINSIC
coiled coil region 223 270 N/A INTRINSIC
low complexity region 355 366 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a chemokine receptor belonging to the G protein-coupled receptor superfamily. The family members are characterized by the presence of 7 transmembrane domains and numerous conserved amino acids. This receptor is most closely related to RBS11 and the MIP1-alpha/RANTES receptor. It transduces a signal by increasing the intracellular calcium ions level. The viral macrophage inflammatory protein-II is an antagonist of this receptor and blocks signaling. Two alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit reduced CD8+ dendritic cell migration in response to XCL1. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T G 10: 79,067,091 T464P probably damaging Het
Abca16 A G 7: 120,527,727 I1214V probably benign Het
Arap2 A G 5: 62,676,517 F869S probably damaging Het
Astn2 G T 4: 65,992,303 H431N possibly damaging Het
Bap1 A G 14: 31,255,651 T308A probably benign Het
Bcr G A 10: 75,131,036 E492K possibly damaging Het
Camta1 A G 4: 151,145,044 F444L probably damaging Het
Chd7 A T 4: 8,844,525 T1545S probably benign Het
Dnmt1 A T 9: 20,915,814 Y877* probably null Het
Fam13b A G 18: 34,497,447 V86A possibly damaging Het
Gm11562 T A 11: 99,619,991 R128W unknown Het
Krt86 A G 15: 101,473,833 I95V probably benign Het
Mgea5 G A 19: 45,767,476 A576V probably benign Het
Mroh2b A G 15: 4,912,802 T349A possibly damaging Het
Ms4a7 A T 19: 11,333,241 L38Q probably damaging Het
Myo1h T C 5: 114,330,160 S339P probably damaging Het
Nf2 T C 11: 4,799,944 I46V probably benign Het
Nr1h4 T C 10: 89,454,930 D416G probably benign Het
Olfr1179 A G 2: 88,402,295 M213T probably benign Het
Olfr323 T C 11: 58,625,458 E196G probably damaging Het
Pde1c C G 6: 56,442,035 E87Q possibly damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Pga5 A T 19: 10,669,415 D317E probably benign Het
Pira2 T A 7: 3,841,068 K568N probably damaging Het
Ppp2cb A G 8: 33,619,133 D290G probably benign Het
Sall4 T C 2: 168,755,070 K617E probably damaging Het
Slc7a14 G A 3: 31,223,579 P626S possibly damaging Het
Speer4b A T 5: 27,497,078 L228* probably null Het
Spns2 T C 11: 72,489,621 T59A probably benign Het
Tbc1d5 A T 17: 50,968,232 N78K probably benign Het
Tmem63a T C 1: 180,961,121 V341A probably benign Het
Trpt1 A G 19: 6,998,315 T146A probably benign Het
Tyrp1 T C 4: 80,835,437 C122R probably damaging Het
Uchl1 A G 5: 66,682,475 E120G possibly damaging Het
Ucn3 C T 13: 3,941,295 R119Q possibly damaging Het
Uhrf1bp1l A G 10: 89,806,117 D1050G probably benign Het
Vmn2r2 T G 3: 64,117,187 I658L probably benign Het
Vmn2r96 T A 17: 18,583,820 V444E probably benign Het
Wdr54 A C 6: 83,155,647 probably null Het
Zbtb26 T C 2: 37,436,545 K160E probably benign Het
Zfp157 T G 5: 138,456,510 Y323* probably null Het
Zfp850 A T 7: 27,990,376 F136I probably benign Het
Other mutations in Xcr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03324:Xcr1 APN 9 123856484 missense probably benign 0.26
R0049:Xcr1 UTSW 9 123855875 missense possibly damaging 0.49
R0049:Xcr1 UTSW 9 123855875 missense possibly damaging 0.49
R0318:Xcr1 UTSW 9 123856154 missense possibly damaging 0.92
R0683:Xcr1 UTSW 9 123855875 missense probably benign 0.03
R4107:Xcr1 UTSW 9 123856088 missense possibly damaging 0.67
R4127:Xcr1 UTSW 9 123856496 missense probably damaging 1.00
R4859:Xcr1 UTSW 9 123856647 missense probably benign
R5408:Xcr1 UTSW 9 123856566 missense probably benign 0.00
R5419:Xcr1 UTSW 9 123856310 missense probably benign 0.06
R5817:Xcr1 UTSW 9 123855857 missense possibly damaging 0.94
R6051:Xcr1 UTSW 9 123856116 missense probably benign 0.01
R6384:Xcr1 UTSW 9 123855782 missense probably damaging 1.00
R6395:Xcr1 UTSW 9 123855789 missense probably damaging 0.96
R6528:Xcr1 UTSW 9 123855983 missense probably damaging 1.00
R6594:Xcr1 UTSW 9 123856244 missense probably benign 0.00
R7648:Xcr1 UTSW 9 123856592 missense possibly damaging 0.54
R9276:Xcr1 UTSW 9 123856615 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTGGACCTTGTGCGAAAC -3'
(R):5'- TACTGCCTGTGTTGATCTCAGC -3'

Sequencing Primer
(F):5'- TTGTGCGAAACAAAGTCCTG -3'
(R):5'- TGTTGATCTCAGCACAATGGAG -3'
Posted On 2018-11-28