Incidental Mutation 'R6990:2610008E11Rik'
ID543205
Institutional Source Beutler Lab
Gene Symbol 2610008E11Rik
Ensembl Gene ENSMUSG00000060301
Gene NameRIKEN cDNA 2610008E11 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R6990 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location79064374-79097600 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 79067091 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 464 (T464P)
Ref Sequence ENSEMBL: ENSMUSP00000044020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039271] [ENSMUST00000218854] [ENSMUST00000220220]
Predicted Effect probably damaging
Transcript: ENSMUST00000039271
AA Change: T464P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000044020
Gene: ENSMUSG00000060301
AA Change: T464P

DomainStartEndE-ValueType
KRAB 10 70 6.95e-32 SMART
ZnF_C2H2 215 237 1.61e2 SMART
ZnF_C2H2 243 266 4.24e-4 SMART
ZnF_C2H2 272 295 1.03e-2 SMART
ZnF_C2H2 301 324 1.76e-1 SMART
ZnF_C2H2 330 352 1.45e-2 SMART
ZnF_C2H2 358 380 1.58e-3 SMART
ZnF_C2H2 386 408 2.75e-3 SMART
ZnF_C2H2 414 437 4.61e-5 SMART
ZnF_C2H2 443 465 1.1e-2 SMART
ZnF_C2H2 471 493 5.81e-2 SMART
ZnF_C2H2 499 521 4.79e-3 SMART
ZnF_C2H2 527 549 3.58e-2 SMART
ZnF_C2H2 555 577 3.44e-4 SMART
ZnF_C2H2 583 605 6.78e-3 SMART
ZnF_C2H2 611 633 3.95e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000218854
Predicted Effect probably benign
Transcript: ENSMUST00000220220
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A G 7: 120,527,727 I1214V probably benign Het
Arap2 A G 5: 62,676,517 F869S probably damaging Het
Astn2 G T 4: 65,992,303 H431N possibly damaging Het
Bap1 A G 14: 31,255,651 T308A probably benign Het
Bcr G A 10: 75,131,036 E492K possibly damaging Het
Camta1 A G 4: 151,145,044 F444L probably damaging Het
Chd7 A T 4: 8,844,525 T1545S probably benign Het
Dnmt1 A T 9: 20,915,814 Y877* probably null Het
Fam13b A G 18: 34,497,447 V86A possibly damaging Het
Gm11562 T A 11: 99,619,991 R128W unknown Het
Krt86 A G 15: 101,473,833 I95V probably benign Het
Mgea5 G A 19: 45,767,476 A576V probably benign Het
Mroh2b A G 15: 4,912,802 T349A possibly damaging Het
Ms4a7 A T 19: 11,333,241 L38Q probably damaging Het
Myo1h T C 5: 114,330,160 S339P probably damaging Het
Nf2 T C 11: 4,799,944 I46V probably benign Het
Nr1h4 T C 10: 89,454,930 D416G probably benign Het
Olfr1179 A G 2: 88,402,295 M213T probably benign Het
Olfr323 T C 11: 58,625,458 E196G probably damaging Het
Pde1c C G 6: 56,442,035 E87Q possibly damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Pga5 A T 19: 10,669,415 D317E probably benign Het
Pira2 T A 7: 3,841,068 K568N probably damaging Het
Ppp2cb A G 8: 33,619,133 D290G probably benign Het
Sall4 T C 2: 168,755,070 K617E probably damaging Het
Slc7a14 G A 3: 31,223,579 P626S possibly damaging Het
Speer4b A T 5: 27,497,078 L228* probably null Het
Spns2 T C 11: 72,489,621 T59A probably benign Het
Tbc1d5 A T 17: 50,968,232 N78K probably benign Het
Tmem63a T C 1: 180,961,121 V341A probably benign Het
Trpt1 A G 19: 6,998,315 T146A probably benign Het
Tyrp1 T C 4: 80,835,437 C122R probably damaging Het
Uchl1 A G 5: 66,682,475 E120G possibly damaging Het
Ucn3 C T 13: 3,941,295 R119Q possibly damaging Het
Uhrf1bp1l A G 10: 89,806,117 D1050G probably benign Het
Vmn2r2 T G 3: 64,117,187 I658L probably benign Het
Vmn2r96 T A 17: 18,583,820 V444E probably benign Het
Wdr54 A C 6: 83,155,647 probably null Het
Xcr1 A G 9: 123,856,235 L154P probably benign Het
Zbtb26 T C 2: 37,436,545 K160E probably benign Het
Zfp157 T G 5: 138,456,510 Y323* probably null Het
Zfp850 A T 7: 27,990,376 F136I probably benign Het
Other mutations in 2610008E11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01551:2610008E11Rik APN 10 79088313 missense possibly damaging 0.79
IGL01905:2610008E11Rik APN 10 79067748 missense probably damaging 1.00
IGL02522:2610008E11Rik APN 10 79067799 missense probably benign 0.27
IGL02999:2610008E11Rik APN 10 79067590 missense possibly damaging 0.74
K7371:2610008E11Rik UTSW 10 79067933 missense probably benign 0.01
R0557:2610008E11Rik UTSW 10 79067685 missense probably damaging 0.99
R0761:2610008E11Rik UTSW 10 79067999 missense probably benign 0.00
R1528:2610008E11Rik UTSW 10 79067696 missense possibly damaging 0.72
R1801:2610008E11Rik UTSW 10 79067396 missense probably damaging 1.00
R1923:2610008E11Rik UTSW 10 79067909 missense probably damaging 0.98
R2444:2610008E11Rik UTSW 10 79068727 missense possibly damaging 0.95
R4223:2610008E11Rik UTSW 10 79094452 missense probably damaging 1.00
R4653:2610008E11Rik UTSW 10 79067430 missense probably benign 0.42
R5127:2610008E11Rik UTSW 10 79066992 missense probably damaging 1.00
R5784:2610008E11Rik UTSW 10 79067607 missense possibly damaging 0.68
R6175:2610008E11Rik UTSW 10 79066614 missense probably damaging 0.98
R7055:2610008E11Rik UTSW 10 79067847 missense probably damaging 0.98
R7133:2610008E11Rik UTSW 10 79066639 missense probably benign 0.02
R7133:2610008E11Rik UTSW 10 79066640 missense probably benign 0.33
R7142:2610008E11Rik UTSW 10 79067612 missense probably damaging 1.00
R7382:2610008E11Rik UTSW 10 79067269 missense probably damaging 1.00
R7577:2610008E11Rik UTSW 10 79066491 missense possibly damaging 0.95
R8103:2610008E11Rik UTSW 10 79067834 missense probably benign
R8117:2610008E11Rik UTSW 10 79094455 missense probably benign 0.07
R8296:2610008E11Rik UTSW 10 79067734 missense probably benign 0.09
R8316:2610008E11Rik UTSW 10 79067739 missense probably damaging 1.00
R8477:2610008E11Rik UTSW 10 79088340 missense probably benign 0.00
R8790:2610008E11Rik UTSW 10 79092451 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- CGAGTGAGGTCTGACTTTTGGAAA -3'
(R):5'- CCTCGCTAATCATCAGAAAACGC -3'

Sequencing Primer
(F):5'- ATATGGCTTCTCACCTGAATGG -3'
(R):5'- CAGCATCATAGGATTCATACAGGTG -3'
Posted On2018-11-28