Incidental Mutation 'R6990:Uhrf1bp1l'
ID543207
Institutional Source Beutler Lab
Gene Symbol Uhrf1bp1l
Ensembl Gene ENSMUSG00000019951
Gene NameUHRF1 (ICBP90) binding protein 1-like
Synonyms4930506D01Rik, E030041M21Rik, 2010319N22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.355) question?
Stock #R6990 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location89744991-89819871 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89806117 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1050 (D1050G)
Ref Sequence ENSEMBL: ENSMUSP00000020112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020112] [ENSMUST00000218607] [ENSMUST00000220375]
Predicted Effect probably benign
Transcript: ENSMUST00000020112
AA Change: D1050G

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000020112
Gene: ENSMUSG00000019951
AA Change: D1050G

DomainStartEndE-ValueType
Pfam:Chorein_N 1 103 9.3e-21 PFAM
SCOP:d1c52__ 243 304 5e-3 SMART
low complexity region 788 801 N/A INTRINSIC
low complexity region 862 872 N/A INTRINSIC
coiled coil region 1410 1455 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218607
Predicted Effect probably benign
Transcript: ENSMUST00000218776
Predicted Effect probably benign
Transcript: ENSMUST00000220375
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T G 10: 79,067,091 T464P probably damaging Het
Abca16 A G 7: 120,527,727 I1214V probably benign Het
Arap2 A G 5: 62,676,517 F869S probably damaging Het
Astn2 G T 4: 65,992,303 H431N possibly damaging Het
Bap1 A G 14: 31,255,651 T308A probably benign Het
Bcr G A 10: 75,131,036 E492K possibly damaging Het
Camta1 A G 4: 151,145,044 F444L probably damaging Het
Chd7 A T 4: 8,844,525 T1545S probably benign Het
Dnmt1 A T 9: 20,915,814 Y877* probably null Het
Fam13b A G 18: 34,497,447 V86A possibly damaging Het
Gm11562 T A 11: 99,619,991 R128W unknown Het
Krt86 A G 15: 101,473,833 I95V probably benign Het
Mgea5 G A 19: 45,767,476 A576V probably benign Het
Mroh2b A G 15: 4,912,802 T349A possibly damaging Het
Ms4a7 A T 19: 11,333,241 L38Q probably damaging Het
Myo1h T C 5: 114,330,160 S339P probably damaging Het
Nf2 T C 11: 4,799,944 I46V probably benign Het
Nr1h4 T C 10: 89,454,930 D416G probably benign Het
Olfr1179 A G 2: 88,402,295 M213T probably benign Het
Olfr323 T C 11: 58,625,458 E196G probably damaging Het
Pde1c C G 6: 56,442,035 E87Q possibly damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Pga5 A T 19: 10,669,415 D317E probably benign Het
Pira2 T A 7: 3,841,068 K568N probably damaging Het
Ppp2cb A G 8: 33,619,133 D290G probably benign Het
Sall4 T C 2: 168,755,070 K617E probably damaging Het
Slc7a14 G A 3: 31,223,579 P626S possibly damaging Het
Speer4b A T 5: 27,497,078 L228* probably null Het
Spns2 T C 11: 72,489,621 T59A probably benign Het
Tbc1d5 A T 17: 50,968,232 N78K probably benign Het
Tmem63a T C 1: 180,961,121 V341A probably benign Het
Trpt1 A G 19: 6,998,315 T146A probably benign Het
Tyrp1 T C 4: 80,835,437 C122R probably damaging Het
Uchl1 A G 5: 66,682,475 E120G possibly damaging Het
Ucn3 C T 13: 3,941,295 R119Q possibly damaging Het
Vmn2r2 T G 3: 64,117,187 I658L probably benign Het
Vmn2r96 T A 17: 18,583,820 V444E probably benign Het
Wdr54 A C 6: 83,155,647 probably null Het
Xcr1 A G 9: 123,856,235 L154P probably benign Het
Zbtb26 T C 2: 37,436,545 K160E probably benign Het
Zfp157 T G 5: 138,456,510 Y323* probably null Het
Zfp850 A T 7: 27,990,376 F136I probably benign Het
Other mutations in Uhrf1bp1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Uhrf1bp1l APN 10 89779984 missense probably damaging 1.00
IGL01102:Uhrf1bp1l APN 10 89791378 missense probably benign 0.00
IGL01457:Uhrf1bp1l APN 10 89805762 missense probably benign 0.06
IGL01647:Uhrf1bp1l APN 10 89774120 critical splice donor site probably null
IGL02552:Uhrf1bp1l APN 10 89806743 nonsense probably null
IGL02686:Uhrf1bp1l APN 10 89805193 missense probably benign
miscreant UTSW 10 89779963 missense probably damaging 0.97
scofflaw UTSW 10 89805684 missense probably benign 0.01
R0019:Uhrf1bp1l UTSW 10 89775969 missense probably damaging 1.00
R0505:Uhrf1bp1l UTSW 10 89791443 missense probably damaging 1.00
R0746:Uhrf1bp1l UTSW 10 89805454 missense probably benign 0.37
R1255:Uhrf1bp1l UTSW 10 89745270 missense probably damaging 0.98
R1385:Uhrf1bp1l UTSW 10 89790641 missense possibly damaging 0.92
R1720:Uhrf1bp1l UTSW 10 89782586 missense probably damaging 1.00
R2142:Uhrf1bp1l UTSW 10 89812048 missense probably damaging 1.00
R2312:Uhrf1bp1l UTSW 10 89781133 missense probably damaging 0.99
R2986:Uhrf1bp1l UTSW 10 89806069 missense probably benign 0.00
R4063:Uhrf1bp1l UTSW 10 89816055 missense probably benign 0.38
R4278:Uhrf1bp1l UTSW 10 89806709 splice site probably null
R4854:Uhrf1bp1l UTSW 10 89794484 missense probably damaging 1.00
R4857:Uhrf1bp1l UTSW 10 89779963 missense probably damaging 0.97
R5135:Uhrf1bp1l UTSW 10 89789355 missense probably damaging 1.00
R5467:Uhrf1bp1l UTSW 10 89805099 missense probably damaging 1.00
R5567:Uhrf1bp1l UTSW 10 89808521 missense probably benign 0.18
R5767:Uhrf1bp1l UTSW 10 89787199 missense possibly damaging 0.68
R6191:Uhrf1bp1l UTSW 10 89805318 missense possibly damaging 0.78
R6196:Uhrf1bp1l UTSW 10 89805333 missense probably benign 0.00
R6387:Uhrf1bp1l UTSW 10 89803057 nonsense probably null
R6729:Uhrf1bp1l UTSW 10 89805684 missense probably benign 0.01
R6746:Uhrf1bp1l UTSW 10 89787158 missense probably benign 0.19
R6794:Uhrf1bp1l UTSW 10 89805762 missense probably benign 0.06
R6892:Uhrf1bp1l UTSW 10 89805123 missense probably benign 0.02
R7188:Uhrf1bp1l UTSW 10 89779882 missense probably damaging 0.96
R7226:Uhrf1bp1l UTSW 10 89808641 missense probably benign 0.00
R7376:Uhrf1bp1l UTSW 10 89809656 missense probably damaging 1.00
R7836:Uhrf1bp1l UTSW 10 89816106 missense probably benign 0.00
R8188:Uhrf1bp1l UTSW 10 89812066 missense possibly damaging 0.50
R8343:Uhrf1bp1l UTSW 10 89791419 missense probably benign
R8356:Uhrf1bp1l UTSW 10 89812092 missense probably benign 0.00
R8367:Uhrf1bp1l UTSW 10 89805377 missense probably damaging 1.00
R8391:Uhrf1bp1l UTSW 10 89809743 missense possibly damaging 0.58
R8456:Uhrf1bp1l UTSW 10 89812092 missense probably benign 0.00
R8546:Uhrf1bp1l UTSW 10 89794535 missense probably damaging 1.00
R8728:Uhrf1bp1l UTSW 10 89782720 missense probably benign 0.00
R8816:Uhrf1bp1l UTSW 10 89790735 critical splice donor site probably benign
X0060:Uhrf1bp1l UTSW 10 89805379 missense probably damaging 0.98
Z1177:Uhrf1bp1l UTSW 10 89812072 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- GCTCAGGAGAAATGACCTCAG -3'
(R):5'- CCTGACAATGCCACACTTTG -3'

Sequencing Primer
(F):5'- CCTCAGAAGGGAGTCACACAAAG -3'
(R):5'- AATGCCACACTTTGTCCTGAGG -3'
Posted On2018-11-28