Incidental Mutation 'R6990:Nf2'
ID543208
Institutional Source Beutler Lab
Gene Symbol Nf2
Ensembl Gene ENSMUSG00000009073
Gene Nameneurofibromin 2
Synonymsmoesin-ezrin-radixin-like protein, merlin, schwannomin
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6990 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location4765845-4849536 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4799944 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 46 (I46V)
Ref Sequence ENSEMBL: ENSMUSP00000128494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053079] [ENSMUST00000056290] [ENSMUST00000109910] [ENSMUST00000152656] [ENSMUST00000164190]
Predicted Effect probably benign
Transcript: ENSMUST00000053079
AA Change: I243V

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000055033
Gene: ENSMUSG00000009073
AA Change: I243V

DomainStartEndE-ValueType
B41 18 222 5.26e-81 SMART
FERM_C 226 315 1.08e-30 SMART
Pfam:ERM 347 585 6.3e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056290
AA Change: I243V

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000055061
Gene: ENSMUSG00000009073
AA Change: I243V

DomainStartEndE-ValueType
B41 18 222 5.26e-81 SMART
FERM_C 226 315 1.08e-30 SMART
Pfam:ERM 347 585 6.3e-63 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000091066
Gene: ENSMUSG00000009073
AA Change: I172V

DomainStartEndE-ValueType
B41 2 152 2.21e-33 SMART
FERM_C 156 245 1.08e-30 SMART
Pfam:ERM 277 515 1.7e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109910
AA Change: I243V

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000105536
Gene: ENSMUSG00000009073
AA Change: I243V

DomainStartEndE-ValueType
B41 18 222 5.26e-81 SMART
FERM_C 226 315 1.08e-30 SMART
Pfam:ERM 347 596 5.5e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124878
SMART Domains Protein: ENSMUSP00000132184
Gene: ENSMUSG00000009073

DomainStartEndE-ValueType
Pfam:FERM_M 35 83 1.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137926
SMART Domains Protein: ENSMUSP00000116505
Gene: ENSMUSG00000009073

DomainStartEndE-ValueType
B41 2 116 1.53e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152656
AA Change: I46V

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000128494
Gene: ENSMUSG00000009073
AA Change: I46V

DomainStartEndE-ValueType
Blast:B41 1 28 2e-9 BLAST
PDB:1E5W|A 1 28 7e-6 PDB
FERM_C 29 118 1.08e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164190
SMART Domains Protein: ENSMUSP00000129388
Gene: ENSMUSG00000009073

DomainStartEndE-ValueType
B41 18 181 1.24e-45 SMART
FERM_C 160 229 1.23e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is similar to some members of the ERM (ezrin, radixin, moesin) family of proteins that are thought to link cytoskeletal components with proteins in the cell membrane. This gene product has been shown to interact with cell-surface proteins, proteins involved in cytoskeletal dynamics and proteins involved in regulating ion transport. This gene is expressed at high levels during embryonic development; in adults, significant expression is found in Schwann cells, meningeal cells, lens and nerve. Mutations in this gene are associated with neurofibromatosis type II which is characterized by nervous system and skin tumors and ocular abnormalities. Two predominant isoforms and a number of minor isoforms are produced by alternatively spliced transcripts. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous targeted null mutants lack extraembryonic ectoderm, do not initiate gastrulation and die by embryonic day 7. Heterozygotes develop malignant tumors, especially osteosarcomas. Conditional Schwann cell knockouts resemble neurofibromatosis type 2. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T G 10: 79,067,091 T464P probably damaging Het
Abca16 A G 7: 120,527,727 I1214V probably benign Het
Arap2 A G 5: 62,676,517 F869S probably damaging Het
Astn2 G T 4: 65,992,303 H431N possibly damaging Het
Bap1 A G 14: 31,255,651 T308A probably benign Het
Bcr G A 10: 75,131,036 E492K possibly damaging Het
Camta1 A G 4: 151,145,044 F444L probably damaging Het
Chd7 A T 4: 8,844,525 T1545S probably benign Het
Dnmt1 A T 9: 20,915,814 Y877* probably null Het
Fam13b A G 18: 34,497,447 V86A possibly damaging Het
Gm11562 T A 11: 99,619,991 R128W unknown Het
Krt86 A G 15: 101,473,833 I95V probably benign Het
Mgea5 G A 19: 45,767,476 A576V probably benign Het
Mroh2b A G 15: 4,912,802 T349A possibly damaging Het
Ms4a7 A T 19: 11,333,241 L38Q probably damaging Het
Myo1h T C 5: 114,330,160 S339P probably damaging Het
Nr1h4 T C 10: 89,454,930 D416G probably benign Het
Olfr1179 A G 2: 88,402,295 M213T probably benign Het
Olfr323 T C 11: 58,625,458 E196G probably damaging Het
Pde1c C G 6: 56,442,035 E87Q possibly damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Pga5 A T 19: 10,669,415 D317E probably benign Het
Pira2 T A 7: 3,841,068 K568N probably damaging Het
Ppp2cb A G 8: 33,619,133 D290G probably benign Het
Sall4 T C 2: 168,755,070 K617E probably damaging Het
Slc7a14 G A 3: 31,223,579 P626S possibly damaging Het
Speer4b A T 5: 27,497,078 L228* probably null Het
Spns2 T C 11: 72,489,621 T59A probably benign Het
Tbc1d5 A T 17: 50,968,232 N78K probably benign Het
Tmem63a T C 1: 180,961,121 V341A probably benign Het
Trpt1 A G 19: 6,998,315 T146A probably benign Het
Tyrp1 T C 4: 80,835,437 C122R probably damaging Het
Uchl1 A G 5: 66,682,475 E120G possibly damaging Het
Ucn3 C T 13: 3,941,295 R119Q possibly damaging Het
Uhrf1bp1l A G 10: 89,806,117 D1050G probably benign Het
Vmn2r2 T G 3: 64,117,187 I658L probably benign Het
Vmn2r96 T A 17: 18,583,820 V444E probably benign Het
Wdr54 A C 6: 83,155,647 probably null Het
Xcr1 A G 9: 123,856,235 L154P probably benign Het
Zbtb26 T C 2: 37,436,545 K160E probably benign Het
Zfp157 T G 5: 138,456,510 Y323* probably null Het
Zfp850 A T 7: 27,990,376 F136I probably benign Het
Other mutations in Nf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00832:Nf2 APN 11 4791123 missense probably benign 0.00
IGL01072:Nf2 APN 11 4789713 missense probably null 0.00
IGL01349:Nf2 APN 11 4784472 missense possibly damaging 0.94
IGL01686:Nf2 APN 11 4818613 missense probably benign
IGL01820:Nf2 APN 11 4789655 splice site probably null
IGL02251:Nf2 APN 11 4848873 missense probably null 1.00
IGL02755:Nf2 APN 11 4818542 missense probably damaging 1.00
IGL02859:Nf2 APN 11 4791209 missense probably damaging 1.00
R0331:Nf2 UTSW 11 4794914 missense probably benign 0.21
R0513:Nf2 UTSW 11 4791185 missense possibly damaging 0.56
R0606:Nf2 UTSW 11 4782194 missense possibly damaging 0.90
R0734:Nf2 UTSW 11 4820409 missense probably benign 0.00
R1749:Nf2 UTSW 11 4803694 missense possibly damaging 0.60
R2192:Nf2 UTSW 11 4799899 missense probably damaging 1.00
R4073:Nf2 UTSW 11 4848958 missense probably benign 0.27
R4355:Nf2 UTSW 11 4780613 nonsense probably null
R4629:Nf2 UTSW 11 4848915 missense probably damaging 0.99
R5129:Nf2 UTSW 11 4816145 missense probably benign
R5130:Nf2 UTSW 11 4829862 intron probably benign
R5580:Nf2 UTSW 11 4803689 missense probably damaging 1.00
R5599:Nf2 UTSW 11 4782269 missense probably damaging 1.00
R5840:Nf2 UTSW 11 4816146 missense probably benign 0.24
R6017:Nf2 UTSW 11 4816137 missense possibly damaging 0.95
R6029:Nf2 UTSW 11 4784566 splice site probably null
R6230:Nf2 UTSW 11 4808262 missense possibly damaging 0.81
R6897:Nf2 UTSW 11 4799878 missense probably damaging 1.00
R7155:Nf2 UTSW 11 4799964 missense probably damaging 0.96
R7826:Nf2 UTSW 11 4789750 missense probably benign 0.35
R8427:Nf2 UTSW 11 4791118 missense probably benign 0.00
R8717:Nf2 UTSW 11 4816099 missense probably damaging 1.00
RF028:Nf2 UTSW 11 4829936 frame shift probably null
RF031:Nf2 UTSW 11 4829936 frame shift probably null
RF032:Nf2 UTSW 11 4829936 frame shift probably null
RF033:Nf2 UTSW 11 4829936 frame shift probably null
RF041:Nf2 UTSW 11 4829936 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CTTGGAGAGCTTCGGCAAAG -3'
(R):5'- CTGCTTCCCCAAATCTAGAAGC -3'

Sequencing Primer
(F):5'- TTCGGCAAAGAAGAGAAATGGG -3'
(R):5'- ATCTAGAAGCTGGAAGCCTTCTG -3'
Posted On2018-11-28