Incidental Mutation 'R6990:Spns2'
ID543210
Institutional Source Beutler Lab
Gene Symbol Spns2
Ensembl Gene ENSMUSG00000040447
Gene Namespinster homolog 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6990 (G1)
Quality Score132.008
Status Not validated
Chromosome11
Chromosomal Location72451638-72489904 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 72489621 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 59 (T59A)
Ref Sequence ENSEMBL: ENSMUSP00000044418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045303]
Predicted Effect probably benign
Transcript: ENSMUST00000045303
AA Change: T59A

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000044418
Gene: ENSMUSG00000040447
AA Change: T59A

DomainStartEndE-ValueType
low complexity region 5 53 N/A INTRINSIC
Pfam:Sugar_tr 104 308 7.6e-16 PFAM
Pfam:OATP 106 427 7.2e-13 PFAM
Pfam:MFS_1 108 476 2.7e-37 PFAM
transmembrane domain 506 528 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transporter of sphingosine 1-phosphate, a secreted lipid that is important in cardiovascular, immunological, and neural development. Defects in this gene are a cause of early onset progressive hearing loss. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit symblepharon and impaired egress of T and B cells from the thymus and bone marrow, respectively. Mice homozygous for a different knock-out allele exhibit abnormal immune system, abnormal eye morphology and absent pinna reflex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T G 10: 79,067,091 T464P probably damaging Het
Abca16 A G 7: 120,527,727 I1214V probably benign Het
Arap2 A G 5: 62,676,517 F869S probably damaging Het
Astn2 G T 4: 65,992,303 H431N possibly damaging Het
Bap1 A G 14: 31,255,651 T308A probably benign Het
Bcr G A 10: 75,131,036 E492K possibly damaging Het
Camta1 A G 4: 151,145,044 F444L probably damaging Het
Chd7 A T 4: 8,844,525 T1545S probably benign Het
Dnmt1 A T 9: 20,915,814 Y877* probably null Het
Fam13b A G 18: 34,497,447 V86A possibly damaging Het
Gm11562 T A 11: 99,619,991 R128W unknown Het
Krt86 A G 15: 101,473,833 I95V probably benign Het
Mgea5 G A 19: 45,767,476 A576V probably benign Het
Mroh2b A G 15: 4,912,802 T349A possibly damaging Het
Ms4a7 A T 19: 11,333,241 L38Q probably damaging Het
Myo1h T C 5: 114,330,160 S339P probably damaging Het
Nf2 T C 11: 4,799,944 I46V probably benign Het
Nr1h4 T C 10: 89,454,930 D416G probably benign Het
Olfr1179 A G 2: 88,402,295 M213T probably benign Het
Olfr323 T C 11: 58,625,458 E196G probably damaging Het
Pde1c C G 6: 56,442,035 E87Q possibly damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Pga5 A T 19: 10,669,415 D317E probably benign Het
Pira2 T A 7: 3,841,068 K568N probably damaging Het
Ppp2cb A G 8: 33,619,133 D290G probably benign Het
Sall4 T C 2: 168,755,070 K617E probably damaging Het
Slc7a14 G A 3: 31,223,579 P626S possibly damaging Het
Speer4b A T 5: 27,497,078 L228* probably null Het
Tbc1d5 A T 17: 50,968,232 N78K probably benign Het
Tmem63a T C 1: 180,961,121 V341A probably benign Het
Trpt1 A G 19: 6,998,315 T146A probably benign Het
Tyrp1 T C 4: 80,835,437 C122R probably damaging Het
Uchl1 A G 5: 66,682,475 E120G possibly damaging Het
Ucn3 C T 13: 3,941,295 R119Q possibly damaging Het
Uhrf1bp1l A G 10: 89,806,117 D1050G probably benign Het
Vmn2r2 T G 3: 64,117,187 I658L probably benign Het
Vmn2r96 T A 17: 18,583,820 V444E probably benign Het
Wdr54 A C 6: 83,155,647 probably null Het
Xcr1 A G 9: 123,856,235 L154P probably benign Het
Zbtb26 T C 2: 37,436,545 K160E probably benign Het
Zfp157 T G 5: 138,456,510 Y323* probably null Het
Zfp850 A T 7: 27,990,376 F136I probably benign Het
Other mutations in Spns2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01733:Spns2 APN 11 72456510 missense possibly damaging 0.79
IGL01804:Spns2 APN 11 72457304 missense possibly damaging 0.89
elderly UTSW 11 72456370 critical splice acceptor site probably null
homely UTSW 11 72456860 missense probably damaging 1.00
whistler UTSW 11 72458687 nonsense probably null
Wrinkled UTSW 11 72456878 missense possibly damaging 0.81
R0883:Spns2 UTSW 11 72454397 missense probably damaging 1.00
R1544:Spns2 UTSW 11 72456367 missense probably benign 0.30
R1696:Spns2 UTSW 11 72456347 missense probably benign 0.25
R2046:Spns2 UTSW 11 72459040 missense possibly damaging 0.49
R2164:Spns2 UTSW 11 72458671 missense possibly damaging 0.82
R2259:Spns2 UTSW 11 72457268 missense probably benign 0.35
R4209:Spns2 UTSW 11 72454186 missense probably benign 0.07
R5285:Spns2 UTSW 11 72489479 missense possibly damaging 0.92
R6883:Spns2 UTSW 11 72456370 critical splice acceptor site probably null
R7221:Spns2 UTSW 11 72456916 missense probably benign 0.43
R7227:Spns2 UTSW 11 72458687 nonsense probably null
R7243:Spns2 UTSW 11 72456860 missense probably damaging 1.00
R7390:Spns2 UTSW 11 72456878 missense possibly damaging 0.81
R7699:Spns2 UTSW 11 72489617 nonsense probably null
R7700:Spns2 UTSW 11 72489617 nonsense probably null
R8042:Spns2 UTSW 11 72454177 missense possibly damaging 0.46
R8155:Spns2 UTSW 11 72456568 missense possibly damaging 0.46
R8553:Spns2 UTSW 11 72457227 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCCAGAGGGCTTGGATCTAG -3'
(R):5'- ATGATGTGCCTGGAATGCGC -3'

Sequencing Primer
(F):5'- AAAAGCTCCCTAGGGCATCTGG -3'
(R):5'- CCTGGAATGCGCCTCGG -3'
Posted On2018-11-28