Incidental Mutation 'R6990:Ucn3'
ID543212
Institutional Source Beutler Lab
Gene Symbol Ucn3
Ensembl Gene ENSMUSG00000044988
Gene Nameurocortin 3
SynonymsUrocortin III
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6990 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location3940688-3945349 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 3941295 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 119 (R119Q)
Ref Sequence ENSEMBL: ENSMUSP00000049678 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058610]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058610
AA Change: R119Q

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000049678
Gene: ENSMUSG00000044988
AA Change: R119Q

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 86 94 N/A INTRINSIC
Pfam:CRF 123 160 2.8e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the corticotropin-releasing hormone peptide family that participates in coordinating autonomic, endocrine, and behavioral responses to stress. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional hormone. The pancreatic islets isolated from mice lacking the encoded protein secrete less insulin in response to high glucose concentrations. Transgenic mice overexpressing the encoded protein exhibit a metabolically favorable phenotype resisting obesity and hyperglycemia on a high-fat diet. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for one null allele are protected from the hyperinsulinemia, hyperglycemia, glucose intolerance, hepatic steatosis and hypertriglyceridemia induced by a high-fat diet, and show better glucose tolerance as they age. Mice homozygous for another null allele show improved social memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T G 10: 79,067,091 T464P probably damaging Het
Abca16 A G 7: 120,527,727 I1214V probably benign Het
Arap2 A G 5: 62,676,517 F869S probably damaging Het
Astn2 G T 4: 65,992,303 H431N possibly damaging Het
Bap1 A G 14: 31,255,651 T308A probably benign Het
Bcr G A 10: 75,131,036 E492K possibly damaging Het
Camta1 A G 4: 151,145,044 F444L probably damaging Het
Chd7 A T 4: 8,844,525 T1545S probably benign Het
Dnmt1 A T 9: 20,915,814 Y877* probably null Het
Fam13b A G 18: 34,497,447 V86A possibly damaging Het
Gm11562 T A 11: 99,619,991 R128W unknown Het
Krt86 A G 15: 101,473,833 I95V probably benign Het
Mgea5 G A 19: 45,767,476 A576V probably benign Het
Mroh2b A G 15: 4,912,802 T349A possibly damaging Het
Ms4a7 A T 19: 11,333,241 L38Q probably damaging Het
Myo1h T C 5: 114,330,160 S339P probably damaging Het
Nf2 T C 11: 4,799,944 I46V probably benign Het
Nr1h4 T C 10: 89,454,930 D416G probably benign Het
Olfr1179 A G 2: 88,402,295 M213T probably benign Het
Olfr323 T C 11: 58,625,458 E196G probably damaging Het
Pde1c C G 6: 56,442,035 E87Q possibly damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Pga5 A T 19: 10,669,415 D317E probably benign Het
Pira2 T A 7: 3,841,068 K568N probably damaging Het
Ppp2cb A G 8: 33,619,133 D290G probably benign Het
Sall4 T C 2: 168,755,070 K617E probably damaging Het
Slc7a14 G A 3: 31,223,579 P626S possibly damaging Het
Speer4b A T 5: 27,497,078 L228* probably null Het
Spns2 T C 11: 72,489,621 T59A probably benign Het
Tbc1d5 A T 17: 50,968,232 N78K probably benign Het
Tmem63a T C 1: 180,961,121 V341A probably benign Het
Trpt1 A G 19: 6,998,315 T146A probably benign Het
Tyrp1 T C 4: 80,835,437 C122R probably damaging Het
Uchl1 A G 5: 66,682,475 E120G possibly damaging Het
Uhrf1bp1l A G 10: 89,806,117 D1050G probably benign Het
Vmn2r2 T G 3: 64,117,187 I658L probably benign Het
Vmn2r96 T A 17: 18,583,820 V444E probably benign Het
Wdr54 A C 6: 83,155,647 probably null Het
Xcr1 A G 9: 123,856,235 L154P probably benign Het
Zbtb26 T C 2: 37,436,545 K160E probably benign Het
Zfp157 T G 5: 138,456,510 Y323* probably null Het
Zfp850 A T 7: 27,990,376 F136I probably benign Het
Other mutations in Ucn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
confection UTSW 13 3941556 missense probably benign 0.33
R1664:Ucn3 UTSW 13 3941634 missense possibly damaging 0.96
R2408:Ucn3 UTSW 13 3941413 missense probably benign
R5288:Ucn3 UTSW 13 3941474 missense probably benign 0.18
R5385:Ucn3 UTSW 13 3941474 missense probably benign 0.18
R5707:Ucn3 UTSW 13 3941556 missense probably benign 0.33
R5954:Ucn3 UTSW 13 3941413 missense probably benign
R7011:Ucn3 UTSW 13 3941421 missense possibly damaging 0.73
R7215:Ucn3 UTSW 13 3941365 missense probably benign 0.10
R7330:Ucn3 UTSW 13 3941216 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- CTTGATGTGCCACCCTCATG -3'
(R):5'- AGCCCTATCTGAGGTCAAGAAG -3'

Sequencing Primer
(F):5'- TCATGCCTGGGCTTTGC -3'
(R):5'- CAAGAAGAGCTTTGGCCACCTG -3'
Posted On2018-11-28