Incidental Mutation 'R6990:Bap1'
ID543213
Institutional Source Beutler Lab
Gene Symbol Bap1
Ensembl Gene ENSMUSG00000021901
Gene NameBrca1 associated protein 1
Synonyms2300006C11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6990 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location31251450-31259944 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31255651 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 308 (T308A)
Ref Sequence ENSEMBL: ENSMUSP00000022458 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022458] [ENSMUST00000022459] [ENSMUST00000048603] [ENSMUST00000187156] [ENSMUST00000188453] [ENSMUST00000226310] [ENSMUST00000226565] [ENSMUST00000228437] [ENSMUST00000228930]
Predicted Effect probably benign
Transcript: ENSMUST00000022458
AA Change: T308A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022458
Gene: ENSMUSG00000021901
AA Change: T308A

DomainStartEndE-ValueType
Pfam:Peptidase_C12 5 215 3e-70 PFAM
low complexity region 282 293 N/A INTRINSIC
low complexity region 396 407 N/A INTRINSIC
low complexity region 577 596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000022459
SMART Domains Protein: ENSMUSP00000022459
Gene: ENSMUSG00000021902

DomainStartEndE-ValueType
PHD 97 145 8.45e-3 SMART
RING 160 207 7.46e-1 SMART
RING 250 300 4.87e0 SMART
PHD 252 301 1.16e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000048603
SMART Domains Protein: ENSMUSP00000043281
Gene: ENSMUSG00000019027

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
Pfam:DHC_N2 998 1404 6.3e-146 PFAM
AAA 1558 1697 6.02e-1 SMART
AAA 1839 2077 4.66e0 SMART
low complexity region 2149 2157 N/A INTRINSIC
AAA 2204 2353 2.35e-1 SMART
Pfam:AAA_8 2533 2803 7.7e-84 PFAM
Pfam:MT 2815 3165 9.9e-57 PFAM
Pfam:AAA_9 3185 3410 1.1e-93 PFAM
Pfam:Dynein_heavy 3545 4246 2.7e-275 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000187156
SMART Domains Protein: ENSMUSP00000139903
Gene: ENSMUSG00000021901

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188453
SMART Domains Protein: ENSMUSP00000139824
Gene: ENSMUSG00000021901

DomainStartEndE-ValueType
Pfam:Peptidase_C12 4 137 3.7e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226310
Predicted Effect probably benign
Transcript: ENSMUST00000226565
Predicted Effect probably benign
Transcript: ENSMUST00000228437
Predicted Effect probably benign
Transcript: ENSMUST00000228930
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ubiquitin C-terminal hydrolase subfamily of deubiquitinating enzymes that are involved in the removal of ubiquitin from proteins. The encoded enzyme binds to the breast cancer type 1 susceptibility protein (BRCA1) via the RING finger domain of the latter and acts as a tumor suppressor. In addition, the enzyme may be involved in regulation of transcription, regulation of cell cycle and growth, response to DNA damage and chromatin dynamics. Germline mutations in this gene may be associated with tumor predisposition syndrome (TPDS), which involves increased risk of cancers including malignant mesothelioma, uveal melanoma and cutaneous melanoma. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygous deletion of this gene causes delayed embryonic growth and complete lethality during organogenesis. Systemic or hematopoietic-restricted deletion in adults recapitulates features of myelodysplastic syndrome. Heterozygotes show increased incidence of asbestos-induced malignant mesothelioma. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T G 10: 79,067,091 T464P probably damaging Het
Abca16 A G 7: 120,527,727 I1214V probably benign Het
Arap2 A G 5: 62,676,517 F869S probably damaging Het
Astn2 G T 4: 65,992,303 H431N possibly damaging Het
Bcr G A 10: 75,131,036 E492K possibly damaging Het
Camta1 A G 4: 151,145,044 F444L probably damaging Het
Chd7 A T 4: 8,844,525 T1545S probably benign Het
Dnmt1 A T 9: 20,915,814 Y877* probably null Het
Fam13b A G 18: 34,497,447 V86A possibly damaging Het
Gm11562 T A 11: 99,619,991 R128W unknown Het
Krt86 A G 15: 101,473,833 I95V probably benign Het
Mgea5 G A 19: 45,767,476 A576V probably benign Het
Mroh2b A G 15: 4,912,802 T349A possibly damaging Het
Ms4a7 A T 19: 11,333,241 L38Q probably damaging Het
Myo1h T C 5: 114,330,160 S339P probably damaging Het
Nf2 T C 11: 4,799,944 I46V probably benign Het
Nr1h4 T C 10: 89,454,930 D416G probably benign Het
Olfr1179 A G 2: 88,402,295 M213T probably benign Het
Olfr323 T C 11: 58,625,458 E196G probably damaging Het
Pde1c C G 6: 56,442,035 E87Q possibly damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Pga5 A T 19: 10,669,415 D317E probably benign Het
Pira2 T A 7: 3,841,068 K568N probably damaging Het
Ppp2cb A G 8: 33,619,133 D290G probably benign Het
Sall4 T C 2: 168,755,070 K617E probably damaging Het
Slc7a14 G A 3: 31,223,579 P626S possibly damaging Het
Speer4b A T 5: 27,497,078 L228* probably null Het
Spns2 T C 11: 72,489,621 T59A probably benign Het
Tbc1d5 A T 17: 50,968,232 N78K probably benign Het
Tmem63a T C 1: 180,961,121 V341A probably benign Het
Trpt1 A G 19: 6,998,315 T146A probably benign Het
Tyrp1 T C 4: 80,835,437 C122R probably damaging Het
Uchl1 A G 5: 66,682,475 E120G possibly damaging Het
Ucn3 C T 13: 3,941,295 R119Q possibly damaging Het
Uhrf1bp1l A G 10: 89,806,117 D1050G probably benign Het
Vmn2r2 T G 3: 64,117,187 I658L probably benign Het
Vmn2r96 T A 17: 18,583,820 V444E probably benign Het
Wdr54 A C 6: 83,155,647 probably null Het
Xcr1 A G 9: 123,856,235 L154P probably benign Het
Zbtb26 T C 2: 37,436,545 K160E probably benign Het
Zfp157 T G 5: 138,456,510 Y323* probably null Het
Zfp850 A T 7: 27,990,376 F136I probably benign Het
Other mutations in Bap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00328:Bap1 APN 14 31253569 missense probably damaging 0.97
IGL02110:Bap1 APN 14 31257414 missense probably damaging 0.97
IGL02740:Bap1 APN 14 31256772 missense possibly damaging 0.94
IGL02937:Bap1 APN 14 31258327 missense probably benign 0.07
R0138:Bap1 UTSW 14 31256724 missense probably damaging 1.00
R1221:Bap1 UTSW 14 31257651 missense probably damaging 1.00
R2131:Bap1 UTSW 14 31258331 nonsense probably null
R2204:Bap1 UTSW 14 31256701 missense probably benign 0.10
R3781:Bap1 UTSW 14 31257618 missense possibly damaging 0.71
R4882:Bap1 UTSW 14 31251721 unclassified probably benign
R4897:Bap1 UTSW 14 31258445 unclassified probably benign
R5249:Bap1 UTSW 14 31257286 unclassified probably benign
R6548:Bap1 UTSW 14 31256225 missense probably benign 0.01
R7203:Bap1 UTSW 14 31254169 missense probably damaging 1.00
R7212:Bap1 UTSW 14 31251623 missense probably damaging 0.99
R7414:Bap1 UTSW 14 31253615 missense probably benign 0.05
R7956:Bap1 UTSW 14 31255568 missense probably benign 0.11
R8062:Bap1 UTSW 14 31257508 missense probably benign 0.38
R8070:Bap1 UTSW 14 31256686 missense probably damaging 1.00
R8875:Bap1 UTSW 14 31253565 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATGGTGGAAACCTGGCTCTATC -3'
(R):5'- GGGTCTAGGGTCATGATAGTCC -3'

Sequencing Primer
(F):5'- GTGGAAACCTGGCTCTATCCTTCTC -3'
(R):5'- AGGGTCATGATAGTCCTTTTCAC -3'
Posted On2018-11-28