Incidental Mutation 'R6990:Fam13b'
ID 543218
Institutional Source Beutler Lab
Gene Symbol Fam13b
Ensembl Gene ENSMUSG00000036501
Gene Name family with sequence similarity 13, member B
Synonyms 2610024E20Rik
MMRRC Submission 045096-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.395) question?
Stock # R6990 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 34442352-34506823 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34497447 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 86 (V86A)
Ref Sequence ENSEMBL: ENSMUSP00000038199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040506]
AlphaFold Q8K2H3
Predicted Effect possibly damaging
Transcript: ENSMUST00000040506
AA Change: V86A

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000038199
Gene: ENSMUSG00000036501
AA Change: V86A

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
RhoGAP 36 209 3.28e-44 SMART
coiled coil region 220 240 N/A INTRINSIC
low complexity region 280 295 N/A INTRINSIC
low complexity region 484 495 N/A INTRINSIC
coiled coil region 507 532 N/A INTRINSIC
low complexity region 719 726 N/A INTRINSIC
coiled coil region 778 807 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T G 10: 79,067,091 (GRCm38) T464P probably damaging Het
Abca16 A G 7: 120,527,727 (GRCm38) I1214V probably benign Het
Arap2 A G 5: 62,676,517 (GRCm38) F869S probably damaging Het
Astn2 G T 4: 65,992,303 (GRCm38) H431N possibly damaging Het
Bap1 A G 14: 31,255,651 (GRCm38) T308A probably benign Het
Bcr G A 10: 75,131,036 (GRCm38) E492K possibly damaging Het
Bltp3b A G 10: 89,806,117 (GRCm38) D1050G probably benign Het
Camta1 A G 4: 151,145,044 (GRCm38) F444L probably damaging Het
Chd7 A T 4: 8,844,525 (GRCm38) T1545S probably benign Het
Dnmt1 A T 9: 20,915,814 (GRCm38) Y877* probably null Het
Gm11562 T A 11: 99,619,991 (GRCm38) R128W unknown Het
Krt86 A G 15: 101,473,833 (GRCm38) I95V probably benign Het
Mroh2b A G 15: 4,912,802 (GRCm38) T349A possibly damaging Het
Ms4a7 A T 19: 11,333,241 (GRCm38) L38Q probably damaging Het
Myo1h T C 5: 114,330,160 (GRCm38) S339P probably damaging Het
Nf2 T C 11: 4,799,944 (GRCm38) I46V probably benign Het
Nr1h4 T C 10: 89,454,930 (GRCm38) D416G probably benign Het
Oga G A 19: 45,767,476 (GRCm38) A576V probably benign Het
Or11l3 T C 11: 58,625,458 (GRCm38) E196G probably damaging Het
Or4p18 A G 2: 88,402,295 (GRCm38) M213T probably benign Het
Pde1c C G 6: 56,442,035 (GRCm38) E87Q possibly damaging Het
Peg10 T TCCA 6: 4,756,451 (GRCm38) probably benign Het
Pga5 A T 19: 10,669,415 (GRCm38) D317E probably benign Het
Pira2 T A 7: 3,841,068 (GRCm38) K568N probably damaging Het
Ppp2cb A G 8: 33,619,133 (GRCm38) D290G probably benign Het
Sall4 T C 2: 168,755,070 (GRCm38) K617E probably damaging Het
Slc7a14 G A 3: 31,223,579 (GRCm38) P626S possibly damaging Het
Speer4b A T 5: 27,497,078 (GRCm38) L228* probably null Het
Spns2 T C 11: 72,489,621 (GRCm38) T59A probably benign Het
Tbc1d5 A T 17: 50,968,232 (GRCm38) N78K probably benign Het
Tmem63a T C 1: 180,961,121 (GRCm38) V341A probably benign Het
Trpt1 A G 19: 6,998,315 (GRCm38) T146A probably benign Het
Tyrp1 T C 4: 80,835,437 (GRCm38) C122R probably damaging Het
Uchl1 A G 5: 66,682,475 (GRCm38) E120G possibly damaging Het
Ucn3 C T 13: 3,941,295 (GRCm38) R119Q possibly damaging Het
Vmn2r2 T G 3: 64,117,187 (GRCm38) I658L probably benign Het
Vmn2r96 T A 17: 18,583,820 (GRCm38) V444E probably benign Het
Wdr54 A C 6: 83,155,647 (GRCm38) probably null Het
Xcr1 A G 9: 123,856,235 (GRCm38) L154P probably benign Het
Zbtb26 T C 2: 37,436,545 (GRCm38) K160E probably benign Het
Zfp157 T G 5: 138,456,510 (GRCm38) Y323* probably null Het
Zfp850 A T 7: 27,990,376 (GRCm38) F136I probably benign Het
Other mutations in Fam13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Fam13b APN 18 34,487,096 (GRCm38) missense possibly damaging 0.92
IGL00402:Fam13b APN 18 34,454,718 (GRCm38) missense probably damaging 1.00
IGL00556:Fam13b APN 18 34,497,435 (GRCm38) missense probably damaging 0.99
IGL02123:Fam13b APN 18 34,445,618 (GRCm38) unclassified probably benign
IGL02313:Fam13b APN 18 34,454,656 (GRCm38) missense probably damaging 1.00
IGL02346:Fam13b APN 18 34,462,105 (GRCm38) missense probably benign 0.00
IGL02347:Fam13b APN 18 34,454,704 (GRCm38) missense probably damaging 1.00
IGL02694:Fam13b APN 18 34,451,206 (GRCm38) critical splice donor site probably null
IGL03347:Fam13b APN 18 34,462,051 (GRCm38) splice site probably benign
R0109:Fam13b UTSW 18 34,451,308 (GRCm38) missense probably benign 0.00
R0233:Fam13b UTSW 18 34,448,084 (GRCm38) missense probably damaging 1.00
R0455:Fam13b UTSW 18 34,445,528 (GRCm38) unclassified probably benign
R1229:Fam13b UTSW 18 34,445,583 (GRCm38) missense probably benign 0.05
R1397:Fam13b UTSW 18 34,445,583 (GRCm38) missense probably benign 0.05
R1571:Fam13b UTSW 18 34,497,432 (GRCm38) missense possibly damaging 0.92
R1703:Fam13b UTSW 18 34,451,439 (GRCm38) critical splice acceptor site probably null
R1732:Fam13b UTSW 18 34,487,134 (GRCm38) missense probably benign 0.04
R1777:Fam13b UTSW 18 34,457,760 (GRCm38) missense possibly damaging 0.84
R1956:Fam13b UTSW 18 34,445,329 (GRCm38) missense possibly damaging 0.69
R2296:Fam13b UTSW 18 34,494,761 (GRCm38) missense possibly damaging 0.88
R3881:Fam13b UTSW 18 34,462,059 (GRCm38) critical splice donor site probably null
R3896:Fam13b UTSW 18 34,462,955 (GRCm38) splice site probably benign
R5277:Fam13b UTSW 18 34,462,190 (GRCm38) missense probably benign
R5759:Fam13b UTSW 18 34,497,435 (GRCm38) missense probably damaging 0.99
R5817:Fam13b UTSW 18 34,457,797 (GRCm38) missense possibly damaging 0.93
R5897:Fam13b UTSW 18 34,454,081 (GRCm38) missense possibly damaging 0.83
R6009:Fam13b UTSW 18 34,497,405 (GRCm38) missense possibly damaging 0.92
R6020:Fam13b UTSW 18 34,494,774 (GRCm38) missense probably damaging 1.00
R6087:Fam13b UTSW 18 34,487,139 (GRCm38) missense possibly damaging 0.48
R6151:Fam13b UTSW 18 34,494,277 (GRCm38) missense probably damaging 0.96
R6454:Fam13b UTSW 18 34,457,662 (GRCm38) critical splice donor site probably null
R6464:Fam13b UTSW 18 34,473,631 (GRCm38) nonsense probably null
R6679:Fam13b UTSW 18 34,487,022 (GRCm38) missense possibly damaging 0.53
R6723:Fam13b UTSW 18 34,498,026 (GRCm38) missense possibly damaging 0.86
R7420:Fam13b UTSW 18 34,494,611 (GRCm38) missense probably damaging 1.00
R7517:Fam13b UTSW 18 34,494,607 (GRCm38) missense probably damaging 0.98
R7534:Fam13b UTSW 18 34,498,007 (GRCm38) missense probably damaging 0.97
R7889:Fam13b UTSW 18 34,457,691 (GRCm38) missense probably benign 0.00
R8139:Fam13b UTSW 18 34,473,633 (GRCm38) missense possibly damaging 0.50
R8776:Fam13b UTSW 18 34,451,393 (GRCm38) missense probably damaging 1.00
R8776-TAIL:Fam13b UTSW 18 34,451,393 (GRCm38) missense probably damaging 1.00
R8826:Fam13b UTSW 18 34,498,017 (GRCm38) missense probably damaging 0.96
R9166:Fam13b UTSW 18 34,462,199 (GRCm38) missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- ACTCCCTTAACTATATACCCAGAGG -3'
(R):5'- AGGCTTTCCAAAAGTGTGAGC -3'

Sequencing Primer
(F):5'- TATATACCCAGAGGACAAACAAGG -3'
(R):5'- CCAAAAGTGTGAGCATTTTAAGTTG -3'
Posted On 2018-11-28