Incidental Mutation 'R6990:Pga5'
ID543220
Institutional Source Beutler Lab
Gene Symbol Pga5
Ensembl Gene ENSMUSG00000024738
Gene Namepepsinogen 5, group I
Synonyms1110035E17Rik, Pepf, pepsinogen A5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R6990 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location10668956-10678071 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 10669415 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 317 (D317E)
Ref Sequence ENSEMBL: ENSMUSP00000025647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025647] [ENSMUST00000055115]
Predicted Effect probably benign
Transcript: ENSMUST00000025647
AA Change: D317E

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000025647
Gene: ENSMUSG00000024738
AA Change: D317E

DomainStartEndE-ValueType
Pfam:A1_Propeptide 16 44 1.1e-13 PFAM
Pfam:Asp 73 386 1.1e-112 PFAM
Pfam:TAXi_N 74 229 7.6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000055115
SMART Domains Protein: ENSMUSP00000056958
Gene: ENSMUSG00000043789

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
EGF 70 98 2.2e1 SMART
EGF_CA 142 180 6.91e-9 SMART
EGF_CA 181 219 7.75e-12 SMART
EGF_CA 220 262 1.11e-12 SMART
low complexity region 294 312 N/A INTRINSIC
low complexity region 335 353 N/A INTRINSIC
VWC 378 432 2.91e-6 SMART
VWC 435 488 4.58e-4 SMART
VWC 493 551 2.06e-6 SMART
VWC 560 617 9.74e-8 SMART
VWC 621 676 1.35e-10 SMART
VWC 679 725 2.58e-1 SMART
low complexity region 761 772 N/A INTRINSIC
low complexity region 889 903 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T G 10: 79,067,091 T464P probably damaging Het
Abca16 A G 7: 120,527,727 I1214V probably benign Het
Arap2 A G 5: 62,676,517 F869S probably damaging Het
Astn2 G T 4: 65,992,303 H431N possibly damaging Het
Bap1 A G 14: 31,255,651 T308A probably benign Het
Bcr G A 10: 75,131,036 E492K possibly damaging Het
Camta1 A G 4: 151,145,044 F444L probably damaging Het
Chd7 A T 4: 8,844,525 T1545S probably benign Het
Dnmt1 A T 9: 20,915,814 Y877* probably null Het
Fam13b A G 18: 34,497,447 V86A possibly damaging Het
Gm11562 T A 11: 99,619,991 R128W unknown Het
Krt86 A G 15: 101,473,833 I95V probably benign Het
Mgea5 G A 19: 45,767,476 A576V probably benign Het
Mroh2b A G 15: 4,912,802 T349A possibly damaging Het
Ms4a7 A T 19: 11,333,241 L38Q probably damaging Het
Myo1h T C 5: 114,330,160 S339P probably damaging Het
Nf2 T C 11: 4,799,944 I46V probably benign Het
Nr1h4 T C 10: 89,454,930 D416G probably benign Het
Olfr1179 A G 2: 88,402,295 M213T probably benign Het
Olfr323 T C 11: 58,625,458 E196G probably damaging Het
Pde1c C G 6: 56,442,035 E87Q possibly damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Pira2 T A 7: 3,841,068 K568N probably damaging Het
Ppp2cb A G 8: 33,619,133 D290G probably benign Het
Sall4 T C 2: 168,755,070 K617E probably damaging Het
Slc7a14 G A 3: 31,223,579 P626S possibly damaging Het
Speer4b A T 5: 27,497,078 L228* probably null Het
Spns2 T C 11: 72,489,621 T59A probably benign Het
Tbc1d5 A T 17: 50,968,232 N78K probably benign Het
Tmem63a T C 1: 180,961,121 V341A probably benign Het
Trpt1 A G 19: 6,998,315 T146A probably benign Het
Tyrp1 T C 4: 80,835,437 C122R probably damaging Het
Uchl1 A G 5: 66,682,475 E120G possibly damaging Het
Ucn3 C T 13: 3,941,295 R119Q possibly damaging Het
Uhrf1bp1l A G 10: 89,806,117 D1050G probably benign Het
Vmn2r2 T G 3: 64,117,187 I658L probably benign Het
Vmn2r96 T A 17: 18,583,820 V444E probably benign Het
Wdr54 A C 6: 83,155,647 probably null Het
Xcr1 A G 9: 123,856,235 L154P probably benign Het
Zbtb26 T C 2: 37,436,545 K160E probably benign Het
Zfp157 T G 5: 138,456,510 Y323* probably null Het
Zfp850 A T 7: 27,990,376 F136I probably benign Het
Other mutations in Pga5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01660:Pga5 APN 19 10675092 missense probably damaging 1.00
IGL02037:Pga5 APN 19 10676701 missense probably benign 0.01
IGL02069:Pga5 APN 19 10669399 missense possibly damaging 0.76
IGL02197:Pga5 APN 19 10671913 splice site probably benign
IGL02871:Pga5 APN 19 10671780 splice site probably benign
R0238:Pga5 UTSW 19 10669453 missense probably damaging 1.00
R0238:Pga5 UTSW 19 10669453 missense probably damaging 1.00
R0239:Pga5 UTSW 19 10669453 missense probably damaging 1.00
R0239:Pga5 UTSW 19 10669453 missense probably damaging 1.00
R1573:Pga5 UTSW 19 10673837 missense probably benign 0.13
R1941:Pga5 UTSW 19 10669456 splice site probably null
R4354:Pga5 UTSW 19 10674826 critical splice donor site probably null
R4568:Pga5 UTSW 19 10671852 missense probably damaging 1.00
R5119:Pga5 UTSW 19 10676689 missense probably benign 0.00
R5738:Pga5 UTSW 19 10669660 missense probably benign 0.05
R5864:Pga5 UTSW 19 10675149 missense probably damaging 1.00
R6176:Pga5 UTSW 19 10671785 splice site probably null
R6270:Pga5 UTSW 19 10674861 missense probably benign
R8056:Pga5 UTSW 19 10676797 splice site probably benign
R8348:Pga5 UTSW 19 10671809 missense probably damaging 1.00
R8448:Pga5 UTSW 19 10671809 missense probably damaging 1.00
R8510:Pga5 UTSW 19 10677944 missense possibly damaging 0.73
Z1176:Pga5 UTSW 19 10669159 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATGCCCTCCTCAAAGTTG -3'
(R):5'- ATTATGGACACAGGGACCTCC -3'

Sequencing Primer
(F):5'- GCTCCTGCAATTGTGTGACCG -3'
(R):5'- ACAGGGACCTCCTTGCTGAC -3'
Posted On2018-11-28