Incidental Mutation 'R6949:Vmn2r7'
ID543228
Institutional Source Beutler Lab
Gene Symbol Vmn2r7
Ensembl Gene ENSMUSG00000116028
Gene Name
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R6949 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location64690660-64719602 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 64691121 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 672 (N672D)
Ref Sequence ENSEMBL: ENSMUSP00000131220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161972] [ENSMUST00000168072]
Predicted Effect probably damaging
Transcript: ENSMUST00000161972
AA Change: N763D

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124192
Gene: ENSMUSG00000062200
AA Change: N763D

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 90 507 3.8e-77 PFAM
Pfam:NCD3G 549 602 3.4e-17 PFAM
Pfam:7tm_3 635 869 1.1e-47 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168072
AA Change: N672D

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000131220
Gene: ENSMUSG00000116028
AA Change: N672D

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 416 5.1e-72 PFAM
Pfam:Peripla_BP_6 63 245 6.1e-10 PFAM
Pfam:NCD3G 458 511 1.8e-17 PFAM
Pfam:7tm_3 542 779 4.3e-76 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.8%
  • 20x: 95.1%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank2 G T 3: 127,010,884 D679E probably benign Het
Catsper4 A T 4: 134,225,747 Y96N probably benign Het
Cnksr3 T C 10: 7,160,757 I35V probably benign Het
Col16a1 A G 4: 130,059,323 E424G probably damaging Het
Ctsc G T 7: 88,281,458 G82W probably damaging Het
Cxcr4 T C 1: 128,589,615 D101G probably benign Het
Dapk1 T A 13: 60,736,324 N635K probably benign Het
Dopey1 T C 9: 86,500,860 M282T probably damaging Het
Dpysl4 G A 7: 139,091,999 E172K probably damaging Het
Eif2ak3 T C 6: 70,878,845 I211T probably damaging Het
Fam71f1 T A 6: 29,323,906 I210N probably damaging Het
Fbxw22 A T 9: 109,382,076 W386R probably benign Het
Gm11639 A C 11: 104,909,070 T2931P probably damaging Het
Grm7 A G 6: 110,646,304 K146R probably benign Het
Grm7 C A 6: 111,495,729 P843Q probably damaging Het
Gtf2e2 A G 8: 33,758,698 D171G probably damaging Het
Hyal5 T C 6: 24,876,304 S59P probably benign Het
Il7r T A 15: 9,508,004 T411S probably damaging Het
Kcp T A 6: 29,484,612 probably null Het
Krcc1 T C 6: 71,284,151 Y56H probably benign Het
Lmo2 T A 2: 103,970,673 M1K probably null Het
Lrit3 G A 3: 129,789,285 T351I probably damaging Het
Mcu T G 10: 59,456,744 T38P possibly damaging Het
Mylk T A 16: 35,000,318 I89N probably damaging Het
Ncoa2 A T 1: 13,156,501 C996S possibly damaging Het
Npr2 A G 4: 43,640,597 E350G probably damaging Het
Olfr1437 T C 19: 12,322,428 Y133C probably damaging Het
Pald1 T C 10: 61,321,217 E818G probably benign Het
Phf19 G T 2: 34,904,131 Q210K probably damaging Het
Pomgnt1 G A 4: 116,154,154 V250M probably damaging Het
Ppm1l T A 3: 69,549,403 C218S possibly damaging Het
Prkdc G A 16: 15,799,989 R3228H probably benign Het
Pros1 A T 16: 62,924,575 T518S probably benign Het
Rdh8 T A 9: 20,822,707 V63D probably benign Het
Rexo1 A G 10: 80,550,636 V196A possibly damaging Het
Scgb2b20 A T 7: 33,366,299 M1K probably null Het
Scn11a A G 9: 119,765,514 V1271A probably benign Het
Serac1 C A 17: 6,051,815 D395Y probably damaging Het
Syne2 A G 12: 75,965,997 D2655G probably benign Het
Tm4sf19 T C 16: 32,405,858 V8A probably benign Het
Usp3 A T 9: 66,520,690 D334E probably benign Het
Uty C T Y: 1,240,000 probably null Het
Vmn2r96 T A 17: 18,597,838 L751H probably damaging Het
Wnk2 T C 13: 49,101,140 S300G probably damaging Het
Zp3r G T 1: 130,577,895 S508R probably benign Het
Other mutations in Vmn2r7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00961:Vmn2r7 APN 3 64715813 missense possibly damaging 0.60
IGL01762:Vmn2r7 APN 3 64691435 missense probably benign 0.39
IGL01903:Vmn2r7 APN 3 64719443 missense probably benign 0.00
IGL02263:Vmn2r7 APN 3 64691447 missense probably damaging 1.00
IGL02458:Vmn2r7 APN 3 64693025 missense probably damaging 0.97
IGL02593:Vmn2r7 APN 3 64693022 missense probably damaging 1.00
IGL02797:Vmn2r7 APN 3 64691245 missense possibly damaging 0.80
IGL03047:Vmn2r7 UTSW 3 64707218 missense possibly damaging 0.81
PIT4504001:Vmn2r7 UTSW 3 64715976 missense probably benign 0.01
R0193:Vmn2r7 UTSW 3 64691039 missense probably damaging 1.00
R0329:Vmn2r7 UTSW 3 64691018 missense probably damaging 1.00
R0609:Vmn2r7 UTSW 3 64716479 missense probably benign 0.44
R0735:Vmn2r7 UTSW 3 64716367 missense probably benign 0.02
R0941:Vmn2r7 UTSW 3 64716579 missense probably benign
R1065:Vmn2r7 UTSW 3 64707138 missense possibly damaging 0.82
R1378:Vmn2r7 UTSW 3 64691604 missense possibly damaging 0.59
R1445:Vmn2r7 UTSW 3 64724802 missense probably benign 0.01
R1506:Vmn2r7 UTSW 3 64707079 missense probably benign
R1509:Vmn2r7 UTSW 3 64716460 nonsense probably null
R1519:Vmn2r7 UTSW 3 64716455 missense possibly damaging 0.95
R1706:Vmn2r7 UTSW 3 64691459 missense possibly damaging 0.79
R2113:Vmn2r7 UTSW 3 64691604 missense possibly damaging 0.59
R3725:Vmn2r7 UTSW 3 64724991 missense possibly damaging 0.65
R3874:Vmn2r7 UTSW 3 64719611 missense possibly damaging 0.69
R3902:Vmn2r7 UTSW 3 64719516 missense possibly damaging 0.46
R4084:Vmn2r7 UTSW 3 64692993 missense probably benign 0.08
R4117:Vmn2r7 UTSW 3 64715717 intron probably benign
R4333:Vmn2r7 UTSW 3 64690778 missense probably damaging 1.00
R4551:Vmn2r7 UTSW 3 64690689 missense possibly damaging 0.86
R4643:Vmn2r7 UTSW 3 64716404 missense probably damaging 1.00
R4654:Vmn2r7 UTSW 3 64719443 missense probably benign 0.00
R5091:Vmn2r7 UTSW 3 64690784 missense possibly damaging 0.63
R5109:Vmn2r7 UTSW 3 64690667 missense probably null 0.84
R5372:Vmn2r7 UTSW 3 64716324 missense probably damaging 1.00
R5415:Vmn2r7 UTSW 3 64716237 missense probably benign 0.07
R5740:Vmn2r7 UTSW 3 64707233 missense probably benign
R5977:Vmn2r7 UTSW 3 64716043 nonsense probably null
R6019:Vmn2r7 UTSW 3 64716222 missense probably damaging 1.00
R6058:Vmn2r7 UTSW 3 64725015 missense probably benign 0.00
R6139:Vmn2r7 UTSW 3 64715918 missense probably damaging 1.00
R6696:Vmn2r7 UTSW 3 64707074 missense probably benign 0.01
R6887:Vmn2r7 UTSW 3 64690827 missense probably damaging 1.00
R6918:Vmn2r7 UTSW 3 64691339 missense probably benign 0.03
R6980:Vmn2r7 UTSW 3 64716566 missense possibly damaging 0.67
R7196:Vmn2r7 UTSW 3 64715777 missense probably benign 0.00
R7286:Vmn2r7 UTSW 3 64690880 missense probably benign 0.00
R7455:Vmn2r7 UTSW 3 64716593 missense probably benign
R7557:Vmn2r7 UTSW 3 64724973 missense probably benign
R7864:Vmn2r7 UTSW 3 64691526 missense probably benign 0.10
R8046:Vmn2r7 UTSW 3 64707058 missense probably damaging 1.00
R8068:Vmn2r7 UTSW 3 64716086 missense probably benign 0.01
R8252:Vmn2r7 UTSW 3 64693106 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTGGTGCCCAAGTAAGCAGG -3'
(R):5'- CATTCTTGGAAAGACTGTTTCACTC -3'

Sequencing Primer
(F):5'- GACCAGCATTCCAAAAGTGATAC -3'
(R):5'- CTCGGCTAATATCCATGC -3'
Posted On2018-11-28