Incidental Mutation 'R6949:Lrit3'
ID543231
Institutional Source Beutler Lab
Gene Symbol Lrit3
Ensembl Gene ENSMUSG00000093865
Gene Nameleucine-rich repeat, immunoglobulin-like and transmembrane domains 3
SynonymsLOC242235
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6949 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location129787881-129804030 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 129789285 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 351 (T351I)
Ref Sequence ENSEMBL: ENSMUSP00000140184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179187] [ENSMUST00000185462]
Predicted Effect probably benign
Transcript: ENSMUST00000179187
SMART Domains Protein: ENSMUSP00000136912
Gene: ENSMUSG00000093865

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 20 61 2.7e-1 SMART
LRR 80 103 6.96e0 SMART
LRR 104 127 3.27e1 SMART
LRR_TYP 128 151 4.47e-3 SMART
LRR_TYP 152 175 7.37e-4 SMART
LRRCT 201 252 4.65e-2 SMART
Blast:IG 260 297 9e-13 BLAST
low complexity region 298 311 N/A INTRINSIC
FN3 364 443 1.85e0 SMART
transmembrane domain 462 484 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000185462
AA Change: T351I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140184
Gene: ENSMUSG00000093865
AA Change: T351I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 20 61 1.3e-3 SMART
LRR 80 103 2.9e-2 SMART
LRR 104 127 1.4e-1 SMART
LRR_TYP 128 151 1.9e-5 SMART
LRR_TYP 152 175 3.2e-6 SMART
LRRCT 201 252 2.3e-4 SMART
IGc2 266 335 4.7e-11 SMART
low complexity region 340 352 N/A INTRINSIC
low complexity region 362 376 N/A INTRINSIC
low complexity region 408 432 N/A INTRINSIC
FN3 485 564 9e-3 SMART
transmembrane domain 583 605 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.8%
  • 20x: 95.1%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has a fibronectin type III domain and a C-terminal transmembrane domain, as well as a leucine-rich repeat domain and immunoglobulin-like domain near the N-terminus. The encoded protein may regulate fibroblast growth factor receptors and affect the modification of these receptors, which are glycosylated differently in the Golgi and endoplasmic reticulum. Mutations in this gene are associated with congenital stationary night blindness, type 1F. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a targeted allele show a selective absence of the ERG b-wave with a normal a-wave component under scotopic conditions, as well as variable ERG responses with larger a-wave amplitudes, shorter b-wave amplitudes, and longer implicit times of both waves under photopic conditions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank2 G T 3: 127,010,884 D679E probably benign Het
Catsper4 A T 4: 134,225,747 Y96N probably benign Het
Cnksr3 T C 10: 7,160,757 I35V probably benign Het
Col16a1 A G 4: 130,059,323 E424G probably damaging Het
Ctsc G T 7: 88,281,458 G82W probably damaging Het
Cxcr4 T C 1: 128,589,615 D101G probably benign Het
Dapk1 T A 13: 60,736,324 N635K probably benign Het
Dopey1 T C 9: 86,500,860 M282T probably damaging Het
Dpysl4 G A 7: 139,091,999 E172K probably damaging Het
Eif2ak3 T C 6: 70,878,845 I211T probably damaging Het
Fam71f1 T A 6: 29,323,906 I210N probably damaging Het
Fbxw22 A T 9: 109,382,076 W386R probably benign Het
Gm11639 A C 11: 104,909,070 T2931P probably damaging Het
Grm7 A G 6: 110,646,304 K146R probably benign Het
Grm7 C A 6: 111,495,729 P843Q probably damaging Het
Gtf2e2 A G 8: 33,758,698 D171G probably damaging Het
Hyal5 T C 6: 24,876,304 S59P probably benign Het
Il7r T A 15: 9,508,004 T411S probably damaging Het
Kcp T A 6: 29,484,612 probably null Het
Krcc1 T C 6: 71,284,151 Y56H probably benign Het
Lmo2 T A 2: 103,970,673 M1K probably null Het
Mcu T G 10: 59,456,744 T38P possibly damaging Het
Mylk T A 16: 35,000,318 I89N probably damaging Het
Ncoa2 A T 1: 13,156,501 C996S possibly damaging Het
Npr2 A G 4: 43,640,597 E350G probably damaging Het
Olfr1437 T C 19: 12,322,428 Y133C probably damaging Het
Pald1 T C 10: 61,321,217 E818G probably benign Het
Phf19 G T 2: 34,904,131 Q210K probably damaging Het
Pomgnt1 G A 4: 116,154,154 V250M probably damaging Het
Ppm1l T A 3: 69,549,403 C218S possibly damaging Het
Prkdc G A 16: 15,799,989 R3228H probably benign Het
Pros1 A T 16: 62,924,575 T518S probably benign Het
Rdh8 T A 9: 20,822,707 V63D probably benign Het
Rexo1 A G 10: 80,550,636 V196A possibly damaging Het
Scgb2b20 A T 7: 33,366,299 M1K probably null Het
Scn11a A G 9: 119,765,514 V1271A probably benign Het
Serac1 C A 17: 6,051,815 D395Y probably damaging Het
Syne2 A G 12: 75,965,997 D2655G probably benign Het
Tm4sf19 T C 16: 32,405,858 V8A probably benign Het
Usp3 A T 9: 66,520,690 D334E probably benign Het
Uty C T Y: 1,240,000 probably null Het
Vmn2r7 T C 3: 64,691,121 N672D probably damaging Het
Vmn2r96 T A 17: 18,597,838 L751H probably damaging Het
Wnk2 T C 13: 49,101,140 S300G probably damaging Het
Zp3r G T 1: 130,577,895 S508R probably benign Het
Other mutations in Lrit3
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4304:Lrit3 UTSW 3 129788819 small insertion probably benign
FR4340:Lrit3 UTSW 3 129788808 small insertion probably benign
FR4548:Lrit3 UTSW 3 129788813 small insertion probably benign
FR4548:Lrit3 UTSW 3 129788816 small insertion probably benign
FR4589:Lrit3 UTSW 3 129803913 frame shift probably null
FR4737:Lrit3 UTSW 3 129788806 small insertion probably benign
FR4737:Lrit3 UTSW 3 129788810 small insertion probably benign
FR4737:Lrit3 UTSW 3 129803913 frame shift probably null
FR4976:Lrit3 UTSW 3 129803910 unclassified probably benign
R0555:Lrit3 UTSW 3 129791296 missense probably damaging 1.00
R0629:Lrit3 UTSW 3 129788302 missense probably damaging 1.00
R0631:Lrit3 UTSW 3 129788555 missense probably damaging 1.00
R1690:Lrit3 UTSW 3 129800745 missense probably damaging 0.99
R1902:Lrit3 UTSW 3 129791246 missense probably benign 0.17
R1955:Lrit3 UTSW 3 129800481 missense probably benign 0.11
R3155:Lrit3 UTSW 3 129791395 missense probably benign 0.00
R4005:Lrit3 UTSW 3 129791372 missense probably benign 0.14
R4445:Lrit3 UTSW 3 129788531 nonsense probably null
R4675:Lrit3 UTSW 3 129788472 missense probably damaging 1.00
R5104:Lrit3 UTSW 3 129788391 missense possibly damaging 0.86
R5147:Lrit3 UTSW 3 129803925 missense possibly damaging 0.78
R5271:Lrit3 UTSW 3 129788301 missense probably damaging 1.00
R5505:Lrit3 UTSW 3 129791438 missense possibly damaging 0.83
R5587:Lrit3 UTSW 3 129788898 missense probably benign 0.25
R6056:Lrit3 UTSW 3 129789355 missense probably damaging 1.00
R6239:Lrit3 UTSW 3 129800346 missense probably damaging 0.98
R6280:Lrit3 UTSW 3 129788763 missense probably damaging 0.99
R6305:Lrit3 UTSW 3 129800460 missense probably damaging 0.98
R6441:Lrit3 UTSW 3 129800360 missense probably benign
R6947:Lrit3 UTSW 3 129789234 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACACTGGTGGTTGCAGAAGC -3'
(R):5'- TGGCAGGTCCTAGACTTCATG -3'

Sequencing Primer
(F):5'- CAGCTGAGAAGATGGGAGGC -3'
(R):5'- AGGTCCTAGACTTCATGTGTACACG -3'
Posted On2018-11-28