Incidental Mutation 'R6949:Scn11a'
ID543250
Institutional Source Beutler Lab
Gene Symbol Scn11a
Ensembl Gene ENSMUSG00000034115
Gene Namesodium channel, voltage-gated, type XI, alpha
SynonymsNaN, NSS2, NaT, SNS2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R6949 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location119753759-119825456 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119765514 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1271 (V1271A)
Ref Sequence ENSEMBL: ENSMUSP00000149420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070617] [ENSMUST00000215718]
Predicted Effect probably benign
Transcript: ENSMUST00000070617
AA Change: V1271A

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000065466
Gene: ENSMUSG00000034115
AA Change: V1271A

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
Pfam:Ion_trans 128 409 1.1e-72 PFAM
low complexity region 475 487 N/A INTRINSIC
Pfam:Ion_trans 574 810 4e-57 PFAM
Pfam:Na_trans_assoc 814 1030 4.1e-29 PFAM
Pfam:Ion_trans 1034 1300 5.7e-66 PFAM
Pfam:Ion_trans 1346 1595 3e-58 PFAM
low complexity region 1683 1694 N/A INTRINSIC
low complexity region 1733 1744 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000215718
AA Change: V1271A

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.8%
  • 20x: 95.1%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family, and is highly expressed in nociceptive neurons of dorsal root ganglia and trigeminal ganglia. It mediates brain-derived neurotrophic factor-evoked membrane depolarization and is a major effector of peripheral inflammatory pain hypersensitivity. Mutations in this gene have been associated with hereditary sensory and autonomic neuropathy type VII and familial episodic pain syndrome-3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous and heterozygous for one null allele display decreased duration of inflammation induced thermal hyperalgesia and decreased late phase pain responses to inflammatory stimuli. Mice homozygous for a second allele appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank2 G T 3: 127,010,884 D679E probably benign Het
Catsper4 A T 4: 134,225,747 Y96N probably benign Het
Cnksr3 T C 10: 7,160,757 I35V probably benign Het
Col16a1 A G 4: 130,059,323 E424G probably damaging Het
Ctsc G T 7: 88,281,458 G82W probably damaging Het
Cxcr4 T C 1: 128,589,615 D101G probably benign Het
Dapk1 T A 13: 60,736,324 N635K probably benign Het
Dopey1 T C 9: 86,500,860 M282T probably damaging Het
Dpysl4 G A 7: 139,091,999 E172K probably damaging Het
Eif2ak3 T C 6: 70,878,845 I211T probably damaging Het
Fam71f1 T A 6: 29,323,906 I210N probably damaging Het
Fbxw22 A T 9: 109,382,076 W386R probably benign Het
Gm11639 A C 11: 104,909,070 T2931P probably damaging Het
Grm7 A G 6: 110,646,304 K146R probably benign Het
Grm7 C A 6: 111,495,729 P843Q probably damaging Het
Gtf2e2 A G 8: 33,758,698 D171G probably damaging Het
Hyal5 T C 6: 24,876,304 S59P probably benign Het
Il7r T A 15: 9,508,004 T411S probably damaging Het
Kcp T A 6: 29,484,612 probably null Het
Krcc1 T C 6: 71,284,151 Y56H probably benign Het
Lmo2 T A 2: 103,970,673 M1K probably null Het
Lrit3 G A 3: 129,789,285 T351I probably damaging Het
Mcu T G 10: 59,456,744 T38P possibly damaging Het
Mylk T A 16: 35,000,318 I89N probably damaging Het
Ncoa2 A T 1: 13,156,501 C996S possibly damaging Het
Npr2 A G 4: 43,640,597 E350G probably damaging Het
Olfr1437 T C 19: 12,322,428 Y133C probably damaging Het
Pald1 T C 10: 61,321,217 E818G probably benign Het
Phf19 G T 2: 34,904,131 Q210K probably damaging Het
Pomgnt1 G A 4: 116,154,154 V250M probably damaging Het
Ppm1l T A 3: 69,549,403 C218S possibly damaging Het
Prkdc G A 16: 15,799,989 R3228H probably benign Het
Pros1 A T 16: 62,924,575 T518S probably benign Het
Rdh8 T A 9: 20,822,707 V63D probably benign Het
Rexo1 A G 10: 80,550,636 V196A possibly damaging Het
Scgb2b20 A T 7: 33,366,299 M1K probably null Het
Serac1 C A 17: 6,051,815 D395Y probably damaging Het
Syne2 A G 12: 75,965,997 D2655G probably benign Het
Tm4sf19 T C 16: 32,405,858 V8A probably benign Het
Usp3 A T 9: 66,520,690 D334E probably benign Het
Uty C T Y: 1,240,000 probably null Het
Vmn2r7 T C 3: 64,691,121 N672D probably damaging Het
Vmn2r96 T A 17: 18,597,838 L751H probably damaging Het
Wnk2 T C 13: 49,101,140 S300G probably damaging Het
Zp3r G T 1: 130,577,895 S508R probably benign Het
Other mutations in Scn11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Scn11a APN 9 119770506 missense probably benign 0.00
IGL00272:Scn11a APN 9 119816603 missense probably damaging 0.98
IGL00332:Scn11a APN 9 119769916 missense probably damaging 1.00
IGL00533:Scn11a APN 9 119774381 missense probably damaging 1.00
IGL00972:Scn11a APN 9 119793938 missense probably benign 0.44
IGL01338:Scn11a APN 9 119784161 splice site probably benign
IGL01534:Scn11a APN 9 119780822 missense probably benign 0.27
IGL01838:Scn11a APN 9 119758583 missense probably damaging 1.00
IGL01991:Scn11a APN 9 119819904 missense probably damaging 0.97
IGL02057:Scn11a APN 9 119765470 missense probably damaging 1.00
IGL02290:Scn11a APN 9 119774442 missense probably damaging 0.97
IGL02454:Scn11a APN 9 119758544 missense probably benign 0.00
IGL02517:Scn11a APN 9 119792398 missense probably damaging 1.00
IGL02567:Scn11a APN 9 119804489 missense probably damaging 0.99
IGL02587:Scn11a APN 9 119805684 missense probably damaging 1.00
IGL03069:Scn11a APN 9 119789963 missense probably benign 0.16
IGL03171:Scn11a APN 9 119819847 missense probably benign 0.00
Kleinie UTSW 9 119803503 missense probably benign 0.16
H8441:Scn11a UTSW 9 119807910 missense probably damaging 1.00
PIT4449001:Scn11a UTSW 9 119769948 missense probably damaging 1.00
R0304:Scn11a UTSW 9 119819862 missense probably benign 0.00
R0519:Scn11a UTSW 9 119790119 missense probably damaging 1.00
R0658:Scn11a UTSW 9 119811160 missense probably benign 0.41
R0828:Scn11a UTSW 9 119755007 missense probably benign 0.00
R0893:Scn11a UTSW 9 119803330 splice site probably null
R0932:Scn11a UTSW 9 119807810 missense probably damaging 1.00
R1061:Scn11a UTSW 9 119795663 missense probably damaging 0.98
R1161:Scn11a UTSW 9 119755057 nonsense probably null
R1162:Scn11a UTSW 9 119805644 splice site probably benign
R1310:Scn11a UTSW 9 119755057 nonsense probably null
R1589:Scn11a UTSW 9 119769807 missense probably damaging 1.00
R1681:Scn11a UTSW 9 119804412 missense possibly damaging 0.46
R1781:Scn11a UTSW 9 119755082 missense probably damaging 1.00
R1812:Scn11a UTSW 9 119780865 nonsense probably null
R1901:Scn11a UTSW 9 119779036 nonsense probably null
R1978:Scn11a UTSW 9 119780795 nonsense probably null
R1985:Scn11a UTSW 9 119754678 missense probably benign 0.19
R2022:Scn11a UTSW 9 119811208 missense possibly damaging 0.88
R2072:Scn11a UTSW 9 119811208 missense possibly damaging 0.88
R2098:Scn11a UTSW 9 119792494 missense possibly damaging 0.67
R2163:Scn11a UTSW 9 119755025 missense probably damaging 1.00
R2250:Scn11a UTSW 9 119758602 missense probably benign 0.01
R2373:Scn11a UTSW 9 119813186 missense probably benign 0.43
R2508:Scn11a UTSW 9 119765529 missense probably damaging 1.00
R3757:Scn11a UTSW 9 119803503 missense probably benign 0.16
R3767:Scn11a UTSW 9 119784049 missense probably damaging 1.00
R3770:Scn11a UTSW 9 119784049 missense probably damaging 1.00
R4089:Scn11a UTSW 9 119795653 splice site probably null
R4092:Scn11a UTSW 9 119789970 missense probably benign 0.03
R4247:Scn11a UTSW 9 119807886 missense probably damaging 1.00
R4279:Scn11a UTSW 9 119754362 missense probably benign 0.25
R4299:Scn11a UTSW 9 119765506 missense probably damaging 0.97
R4403:Scn11a UTSW 9 119795667 missense probably damaging 1.00
R4468:Scn11a UTSW 9 119754987 missense probably damaging 1.00
R4542:Scn11a UTSW 9 119755134 missense probably damaging 1.00
R4644:Scn11a UTSW 9 119815203 splice site probably null
R4739:Scn11a UTSW 9 119754561 missense probably benign 0.39
R4809:Scn11a UTSW 9 119819870 missense probably benign 0.00
R4954:Scn11a UTSW 9 119758659 missense possibly damaging 0.84
R5012:Scn11a UTSW 9 119780878 missense probably benign 0.31
R5044:Scn11a UTSW 9 119819831 missense probably damaging 0.98
R5222:Scn11a UTSW 9 119815202 splice site probably null
R5224:Scn11a UTSW 9 119754792 missense probably damaging 1.00
R5400:Scn11a UTSW 9 119769908 missense probably damaging 0.97
R5555:Scn11a UTSW 9 119755238 missense probably damaging 1.00
R5711:Scn11a UTSW 9 119789924 missense probably damaging 1.00
R5950:Scn11a UTSW 9 119811124 missense probably damaging 1.00
R5984:Scn11a UTSW 9 119784016 missense probably benign
R6057:Scn11a UTSW 9 119765448 missense probably damaging 1.00
R6104:Scn11a UTSW 9 119795678 missense probably damaging 1.00
R6180:Scn11a UTSW 9 119754867 missense probably benign 0.00
R6892:Scn11a UTSW 9 119806969 missense possibly damaging 0.53
R6908:Scn11a UTSW 9 119792426 missense probably damaging 1.00
R7112:Scn11a UTSW 9 119754809 missense probably damaging 1.00
R7232:Scn11a UTSW 9 119759916 missense probably damaging 1.00
R7261:Scn11a UTSW 9 119819833 missense probably damaging 0.99
R7265:Scn11a UTSW 9 119815265 missense probably damaging 1.00
R7302:Scn11a UTSW 9 119806951 missense probably benign 0.03
R7391:Scn11a UTSW 9 119795717 missense probably damaging 1.00
R7441:Scn11a UTSW 9 119758626 missense probably benign 0.01
R7479:Scn11a UTSW 9 119759875 missense probably benign 0.38
R7608:Scn11a UTSW 9 119815313 splice site probably null
R7768:Scn11a UTSW 9 119815272 missense probably benign 0.13
R7785:Scn11a UTSW 9 119816556 missense probably benign 0.00
R7794:Scn11a UTSW 9 119765514 missense probably damaging 0.99
R7818:Scn11a UTSW 9 119784111 missense probably damaging 0.97
R7884:Scn11a UTSW 9 119804551 missense probably benign 0.01
R7988:Scn11a UTSW 9 119765437 missense probably damaging 0.97
R8049:Scn11a UTSW 9 119755083 missense probably damaging 1.00
R8127:Scn11a UTSW 9 119804512 missense probably damaging 1.00
R8274:Scn11a UTSW 9 119803482 missense probably benign
R8344:Scn11a UTSW 9 119781970 missense probably benign 0.00
R8346:Scn11a UTSW 9 119778981 missense probably damaging 1.00
Z1088:Scn11a UTSW 9 119755242 missense probably damaging 1.00
Z1177:Scn11a UTSW 9 119754998 missense possibly damaging 0.94
Z1177:Scn11a UTSW 9 119819820 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAACAGCCTTCTTTCTACATTAGC -3'
(R):5'- GCATCTGGAGCTTAGCAAGG -3'

Sequencing Primer
(F):5'- CATCACATTCCCTGCAAGCATTGG -3'
(R):5'- CCGGCAGGATGCTATGTGTTTAAAC -3'
Posted On2018-11-28